Rosalind Textbook track 문제풀이

Python
Rosalind
Bioinformatics
Tip
Author

Taeyoon Kim

Published

September 28, 2024

Modified

August 12, 2026

Phillip Compeau 와 Pavel Pevzner 가 쓴 책 “능동적 접근 방식의 생물정보학 알고리즘” 에서 제공되는 연습 문제 모음입니다.

Rosalind프로젝트 오일러, 구글 코드 잼 에서 영감을 얻었습니다. 이 프로젝트의 이름은 DNA 이중나선을 발견하는 데 기여한 로잘린드 프랭클린 에서 따왔습니다. Rosalind 는 프로그래밍 실력을 키우고자 하는 생물학자와 분자생물학의 계산 문제를 접해본 적이 없는 프로그래머들에게 도움이 될 것입니다.

0.1 Compute the Number of Times a Pattern Appears in a Text

This is the first problem in a collection of”code challenges”to accompany Bioinformatics Algorithms: An Active-Learning Approach by Phillip Compeau & Pavel Pevzner.

k-mer is a string of length k. We define Count(TextPattern) as the number of times that a k-mer Pattern appears as a substring of Text.

For example, We note that \(Count(CGATATATCCATAGCGATATATCCATAG,ATAATA)\) is equal to 3 (not 2) since we should account for overlapping occurrences of Pattern in Text.

Given: {DNA strings}} Text and Pattern.

Return: Count(TextPattern).

0.2 Sample Dataset

GCGCG
GCG

0.3 Sample Output

2

0.4 Solution

from typing import Generator

def generate_substrings(text: str, size: int) -> Generator[str, None, None]:
    """Generate all substrings of a given size from the text."""
    for i in range(len(text) - size + 1):
        yield text[i:i + size]

def count_pattern_occurrences(text: str, pattern: str) -> int:
    """Count how many times the pattern occurs in the text."""
    return sum(pattern == substring for substring in generate_substrings(text, len(pattern)))

# Sample input
sample_input = """
GCGCG
GCG
"""

# Split input into text and pattern
text, pattern = sample_input.strip().split("\n")

# Print the count of pattern occurrences in text
print(count_pattern_occurrences(text, pattern))

1 Find the Most Frequent Words in a String

We say that Pattern is a most frequent k-mer in Text if it maximizes Count(TextPattern) among all k-mers. For example,“ACTAT”is a most frequent 5-mer in”ACAACTATGCATCACTATCGGGAACTATCCT”, and”ATA”is a most frequent 3-mer of”CGATATATCCATAG”.

Given: A DNA string Text and an integer k.

Return: All most frequent k-mers in Text (in any order).

1.1 Sample Dataset

ACGTTGCATGTCGCATGATGCATGAGAGCT
4

1.2 Sample Output

CATG GCAT

1.3 Solution

from typing import List, Dict, Tuple
from collections import defaultdict

def generate_substrings(text: str, size: int) -> List[str]:
    """Generate all substrings of a given size from the text."""
    return [text[i:i + size] for i in range(len(text) - size + 1)]

def count_kmers(text: str, k: int) -> Dict[str, int]:
    """Count occurrences of each k-mer in the text."""
    kmer_counts = defaultdict(int)
    for kmer in generate_substrings(text, k):
        kmer_counts[kmer] += 1
    return kmer_counts

def most_frequent_kmers(kmer_counts: Dict[str, int]) -> List[str]:
    """Find the most frequent k-mers."""
    max_count = max(kmer_counts.values())
    return [kmer for kmer, count in kmer_counts.items() if count == max_count]

# Sample input
sample_input = """
ACGTTGCATGTCGCATGATGCATGAGAGCT
4
"""

# Split input into text and pattern size
text, k = sample_input.strip().split("\n")
k = int(k)

# Find and print the most frequent k-mers
most_frequent = most_frequent_kmers(count_kmers(text, k))
print(*most_frequent)

2 Find the Reverse Complement of a String

Find the reverse complement of a DNA string.

Given: A DNA string Pattern.

Return: \(\overline{Pattern}\), the reverse complement of Pattern.

2.1 Sample Dataset

AAAACCCGGT

2.2 Sample Output

ACCGGGTTTT

2.3 Solution

def reverse_complement(seq: str) -> str:
    """Return the reverse complement of a DNA sequence."""
    return seq[::-1].translate(str.maketrans("ACGT", "TGCA"))

# Sample input
sample_input = """
AAAACCCGGT
"""

# Process the input and print the reverse complement
sequence = sample_input.strip().split()[0]
print(reverse_complement(sequence))

3 Find All Occurrences of a Pattern in a String

Pattern Matching Problem, Find all occurrences of a pattern in a string.

Given: Strings Pattern and Genome.

Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.

3.1 Sample Dataset

ATAT
GATATATGCATATACTT

3.2 Sample Output

1 3 9

3.3 Solution

from typing import List, Generator

def generate_substrings(text: str, size: int) -> List[str]:
    """Generate all substrings of a given size from the text."""
    return [text[i:i + size] for i in range(len(text) - size + 1)]

def find_pattern_indices(text: str, pattern: str) -> Generator[int, None, None]:
    """Yield starting indices where the pattern is found in the text."""
    for i, substring in enumerate(generate_substrings(text, len(pattern))):
        if substring == pattern:
            yield i

# Sample input
sample_input = """
ATAT
GATATATGCATATACTT
"""

# Split input into pattern and text
pattern, text = sample_input.strip().split("\n")

# Print indices where the pattern is found
print(*find_pattern_indices(text, pattern))

4 Find Patterns Forming Clumps in a String

Clump Finding Problem, Find patterns forming clumps in a string.

Given: A string Genome, and integers kL, and t.

Return: All distinct k-mers forming (Lt)-clumps in Genome.

4.1 Sample Dataset

CGGACTCGACAGATGTGAAGAAATGTGAAGACTGAGTGAAGAGAAGAGGAAACACGACACGACATTGCGACATAATGTACGAATGTAATGTGCCTATGGC
5 75 4

4.2 Sample Output

CGACA GAAGA AATGT

4.3 Solution

from collections import defaultdict
from typing import List, Dict

def generate_substrings(text: str, size: int) -> List[str]:
    """Generate all substrings of a given size from the text."""
    return [text[i:i + size] for i in range(len(text) - size + 1)]

def find_kmers(text: str, k: int) -> Dict[str, List[int]]:
    """Find positions of k-length kmers within the text."""
    kmer_positions = defaultdict(list)
    for i, substring in enumerate(generate_substrings(text, k)):
        kmer_positions[substring].append(i)
    return kmer_positions

def has_clump(positions: List[int], L: int, t: int, k: int) -> bool:
    """Check if a given array of kmers at positions forms a clump of t within L."""
    for i in range(len(positions) - t + 1):
        if (positions[i + t - 1] + k - positions[i]) <= L:
            return True
    return False

# Sample input
sample_input = """
CGGACTCGACAGATGTGAAGAAATGTGAAGACTGAGTGAAGAGAAGAGGAAACACGACACGACATTGCGACATAATGTACGAATGTAATGTGCCTATGGC
5 75 4
"""

# Split input into sequence and parameters
seq, params = sample_input.strip().split("\n")
k, L, t = map(int, params.split())

# Find kmers and print those forming clumps
kmers = find_kmers(seq, k)
clumps = [kmer for kmer in kmers if has_clump(kmers[kmer], L, t, k)]
print(*clumps)

5 Find a Position in a Genome Minimizing the Skew

Minimum Skew Problem, Find a position in a genome minimizing the skew.

Given: A DNA string Genome.

Return: All integer(s) i minimizing Skew(*Prefix__i (Text)) over all values of i (from 0 to |Genome*|).

5.1 Sample Dataset

CCTATCGGTGGATTAGCATGTCCCTGTACGTTTCGCCGCGAACTAGTTCACACGGCTTGATGGCAAATGGTTTTTCCGGCGACCGTAATCGTCCACCGAG

5.2 Sample Output

53 97

5.3 Solution

from typing import Generator

def find_minima(seq: str) -> Generator[int, None, None]:
    """Find positions with the minimum skew in a DNA sequence."""
    skew = [0]
    delta = {"G": 1, "C": -1, "A": 0, "T": 0}
    
    for i, nucleotide in enumerate(seq):
        skew.append(skew[i] + delta[nucleotide])
    
    min_skew = min(skew)
    return (i for i, value in enumerate(skew) if value == min_skew)

# Sample input
sample_input = """
CCTATCGGTGGATTAGCATGTCCCTGTACGTTTCGCCGCGAACTAGTTCACACGGCTTGATGGCAAATGGTTTTTCCGGCGACCGTAATCGTCCACCGAG
"""

# Process the input and print the positions with minimum skew
sequence = sample_input.strip()
print(*find_minima(sequence))

6 Compute the Hamming Distance Between Two Strings

Hamming Distance Problem, Compute the Hamming distance between two DNA strings.

Given: Two DNA strings.

Return: An integer value representing the Hamming distance.

6.1 Sample Dataset

GGGCCGTTGGT
GGACCGTTGAC

6.2 Sample Output

3

6.3 Solution

from itertools import zip_longest
from typing import Tuple

def calculate_hamming_distance(sequence1: str, sequence2: str) -> int:
    return sum(base1 != base2 for base1, base2 in zip_longest(sequence1, sequence2, fillvalue=None))

def parse_dna_sequences(input_string: str) -> Tuple[str, str]:
    return tuple(input_string.strip().split("\n"))

# Sample input
Sample_input = """
GGGCCGTTGGT
GGACCGTTGAC
"""

dna_sequence1, dna_sequence2 = parse_dna_sequences(Sample_input)
hamming_distance = calculate_hamming_distance(dna_sequence1, dna_sequence2)
print(hamming_distance)

7 Find All Approximate Occurrences of a Pattern in a String

Approximate Pattern Matching Problem, Find all approximate occurrences of a pattern in a string.

Given: Strings Pattern and Text along with an integer d.

Return: All starting positions where Pattern appears as a substring of Text with at most d mismatches.

7.1 Sample Dataset

ATTCTGGA
CGCCCGAATCCAGAACGCATTCCCATATTTCGGGACCACTGGCCTCCACGGTACGGACGTCAATCAAATGCCTAGCGGCTTGTGGTTTCTCCTACGCTCC
3

7.2 Sample Output

6 7 26 27 78

7.3 Solution

from typing import Iterator, List

def generate_substrings(dna_sequence: str, substring_length: int) -> Iterator[str]:
    return (dna_sequence[i:i + substring_length] for i in range(len(dna_sequence) - substring_length + 1))

def calculate_hamming_distance(sequence1: str, sequence2: str) -> int:
    return sum(base1 != base2 for base1, base2 in zip(sequence1, sequence2))

def find_approximate_matches(pattern: str, genome: str, max_mismatch: int) -> Iterator[int]:
    pattern_length = len(pattern)
    return (position for position, substring in enumerate(generate_substrings(genome, pattern_length))
            if calculate_hamming_distance(substring, pattern) <= max_mismatch)

def parse_input(input_data: str) -> tuple[str, str, int]:
    pattern, genome, max_mismatch_str = input_data.strip().split("\n")
    return pattern, genome, int(max_mismatch_str)

sample_input = """
ATTCTGGA
CGCCCGAATCCAGAACGCATTCCCATATTTCGGGACCACTGGCCTCCACGGTACGGACGTCAATCAAATGCCTAGCGGCTTGTGGTTTCTCCTACGCTCC
3
"""

pattern, genome, max_mismatch = parse_input(sample_input)
match_positions = list(find_approximate_matches(pattern, genome, max_mismatch))
print(*match_positions)

8 Find the Most Frequent Words with Mismatches in a String

Frequent Words with Mismatches Problem, Find the most frequent k-mers with mismatches in a string.

Given: A string Text as well as integers k and d.

Return: All most frequent k-mers with up to d mismatches in Text.

8.1 Sample Dataset

ACGTTGCATGTCGCATGATGCATGAGAGCT
4 1

8.2 Sample Output

ATGC ATGT GATG

8.3 Solution

from collections import defaultdict
from itertools import product
from typing import Dict, List, Iterator, Tuple

def calculate_hamming_distance(sequence1: str, sequence2: str) -> int:
    return sum(base1 != base2 for base1, base2 in zip(sequence1, sequence2))

def generate_substrings(dna_sequence: str, substring_length: int) -> Iterator[str]:
    return (dna_sequence[i:i + substring_length] for i in range(len(dna_sequence) - substring_length + 1))

def count_kmers(dna_sequence: str, kmer_length: int) -> Dict[str, int]:
    kmer_counts = defaultdict(int)
    for kmer in generate_substrings(dna_sequence, kmer_length):
        kmer_counts[kmer] += 1
    return kmer_counts

def find_most_frequent(kmer_counts: Dict[str, int]) -> List[str]:
    max_count = max(kmer_counts.values())
    return [kmer for kmer, count in kmer_counts.items() if count == max_count]

def generate_all_kmers(kmer_length: int) -> Iterator[str]:
    return ("".join(bases) for bases in product("ACGT", repeat=kmer_length))

def count_approximate_kmers(observed_kmers: Dict[str, int], max_mismatches: int, kmer_length: int) -> Iterator[Tuple[str, int]]:
    for potential_kmer in generate_all_kmers(kmer_length):
        count = sum(observed_kmers[observed_kmer] 
                    for observed_kmer in observed_kmers 
                    if calculate_hamming_distance(potential_kmer, observed_kmer) <= max_mismatches)
        if count > 0:
            yield (potential_kmer, count)

def parse_input(input_data: str) -> Tuple[str, int, int]:
    dna_sequence, params = input_data.strip().split("\n")
    kmer_length, max_mismatches = map(int, params.split())
    return dna_sequence, kmer_length, max_mismatches

sample_input = """
ACGTTGCATGTCGCATGATGCATGAGAGCT
4 1
"""

dna_sequence, kmer_length, max_mismatches = parse_input(sample_input)
observed_kmers = count_kmers(dna_sequence, kmer_length)
approximate_kmer_counts = dict(count_approximate_kmers(observed_kmers, max_mismatches, kmer_length))
most_frequent_kmers = find_most_frequent(approximate_kmer_counts)
print(*most_frequent_kmers)

9 Find Frequent Words with Mismatches and Reverse Complements

Frequent Words with Mismatches and Reverse Complements Problem. Find the most frequent k-mers (with mismatches and reverse complements) in a DNA string.

Given: A DNA string Text as well as integers k and d.

Return: All k-mers Pattern maximizing the sum *Count__d(Text\(Pattern\)) + Count__d(Text\(\overline{Pattern}\)}) over all possible k*-mers.

9.1 Sample Dataset

ACGTTGCATGTCGCATGATGCATGAGAGCT
4 1

9.2 Sample Output

ATGT ACAT

9.3 Solution

from collections import defaultdict
from itertools import product
from typing import Dict, List, Iterator, Tuple

def reverse_complement(dna: str) -> str:
    return dna[::-1].translate(str.maketrans("ACGT", "TGCA"))

def hamming_distance(seq1: str, seq2: str) -> int:
    return sum(base1 != base2 for base1, base2 in zip(seq1, seq2))

def generate_substrings(dna: str, length: int) -> Iterator[str]:
    return (dna[i:i + length] for i in range(len(dna) - length + 1))

def count_kmers(dna: str, kmer_length: int) -> Dict[str, int]:
    kmer_counts = defaultdict(int)
    for kmer in generate_substrings(dna, kmer_length):
        kmer_counts[kmer] += 1
    return kmer_counts

def find_most_frequent(kmer_counts: Dict[str, int]) -> List[str]:
    max_count = max(kmer_counts.values())
    return [kmer for kmer, count in kmer_counts.items() if count == max_count]

def generate_all_kmers(kmer_length: int) -> Iterator[str]:
    return ("".join(bases) for bases in product("ACGT", repeat=kmer_length))

def count_approximate_kmers(kmer_counts: Dict[str, int], max_mismatches: int, kmer_length: int) -> Iterator[Tuple[str, int]]:
    for potential_kmer in generate_all_kmers(kmer_length):
        count = sum(kmer_counts[observed_kmer] for observed_kmer in kmer_counts 
                    if hamming_distance(potential_kmer, observed_kmer) <= max_mismatches)
        count += sum(kmer_counts[observed_kmer] for observed_kmer in kmer_counts 
                     if hamming_distance(reverse_complement(potential_kmer), observed_kmer) <= max_mismatches)
        if count > 0:
            yield (potential_kmer, count)

def parse_input(input_data: str) -> Tuple[str, int, int]:
    dna_sequence, params = input_data.strip().split("\n")
    kmer_length, max_mismatches = map(int, params.split())
    return dna_sequence, kmer_length, max_mismatches

sample_input = """
ACGTTGCATGTCGCATGATGCATGAGAGCT
4 1
"""
dna_sequence, kmer_length, max_mismatches = parse_input(sample_input)
kmer_counts = count_kmers(dna_sequence, kmer_length)
approximate_kmer_counts = dict(count_approximate_kmers(kmer_counts, max_mismatches, kmer_length))
print(*find_most_frequent(approximate_kmer_counts))

10 Generate the Frequency Array of a String

Computing a Frequency Array, Generate the frequency array of a DNA string.

Given: A DNA string Text and an integer k.

Return: The frequency array of k-mers in Text.

10.1 Sample Dataset

ACGCGGCTCTGAAA
2

10.2 Sample Output

2 1 0 0 0 0 2 2 1 2 1 0 0 1 1 0

10.3 Solution

from typing import Iterator, List, Dict, Tuple
from itertools import product

def generate_substrings(text: str, size: int) -> Iterator[str]:
    return (text[i : i + size] for i in range(len(text) - size + 1))

def count_pattern_occurrences(text: str, pattern: str) -> int:
    return sum(pattern == substring for substring in generate_substrings(text, len(pattern)))

def calculate_hamming_distance(s1: str, s2: str) -> int:
    return sum(c1 != c2 for c1, c2 in zip(s1, s2))

def generate_kmers(k: int) -> Iterator[str]:
    return ("".join(bases) for bases in product("ACGT", repeat=k))

def count_approximate_kmers(kmer_counts: Dict[str, int], max_mismatches: int, kmer_length: int) -> Iterator[Tuple[str, int]]:
    for potential_kmer in generate_kmers(kmer_length):
        count = sum(kmer_counts[observed_kmer] for observed_kmer in kmer_counts 
                    if calculate_hamming_distance(potential_kmer, observed_kmer) <= max_mismatches)
        if count > 0:
            yield (potential_kmer, count)

def calculate_kmer_frequencies(sequence: str, kmer_length: int) -> List[int]:
    return [count_pattern_occurrences(sequence, kmer) for kmer in generate_kmers(kmer_length)]

def parse_input(input_data: str) -> Tuple[str, int]:
    sequence, kmer_length = input_data.strip().split("\n")
    return sequence, int(kmer_length)

sample_input = """
ACGCGGCTCTGAAA
2
"""
sequence, kmer_length = parse_input(sample_input)
kmer_frequencies = calculate_kmer_frequencies(sequence, kmer_length)
print(*kmer_frequencies

11 Implement PatternToNumber

Implement PatternToNumber, Convert a DNA string to a number.

Given: A DNA string Pattern.

Return: PatternToNumber(Pattern).

11.1 Sample Dataset

AGT

11.2 Sample Output

11

11.3 Solution

from typing import Dict, Tuple

def create_nucleotide_to_number_map() -> Dict[str, int]:
    return {"A": 0, "C": 1, "G": 2, "T": 3}

def convert_nucleotide_to_number(nucleotide: str, nucleotide_map: Dict[str, int]) -> int:
    return nucleotide_map[nucleotide]

def convert_dna_pattern_to_number(dna_pattern: str, nucleotide_map: Dict[str, int]) -> int:
    if not dna_pattern:
        return 0
    return 4 * convert_dna_pattern_to_number(dna_pattern[:-1], nucleotide_map) + convert_nucleotide_to_number(dna_pattern[-1], nucleotide_map)

def parse_input(input_data: str) -> str:
    return input_data.strip()

sample_input = """
AGT
"""

dna_pattern = parse_input(sample_input)
nucleotide_map = create_nucleotide_to_number_map()
result = convert_dna_pattern_to_number(dna_pattern, nucleotide_map)
print(result)

12 Implement NumberToPattern

Implement NumberToPattern, Convert an integer to its corresponding DNA string.

Given: Integers index and k.

Return: NumberToPattern(indexk).

12.1 Sample Dataset

45
4

12.2 Sample Output

AGTC

12.3 Solution

from typing import Tuple

def number_to_nucleotide(index: int) -> str:
    nucleotides = ["A", "C", "G", "T"]
    return nucleotides[index]

def number_to_dna_pattern(index: int, length: int) -> str:
    if length == 1:
        return number_to_nucleotide(index)
    quotient, remainder = divmod(index, 4)
    return number_to_dna_pattern(quotient, length - 1) + number_to_nucleotide(remainder)

def parse_input(input_data: str) -> Tuple[int, int]:
    index_str, length_str = input_data.strip().split("\n")
    return int(index_str), int(length_str)

sample_input = """
45
4
"""
index, length = parse_input(sample_input)
dna_pattern = number_to_dna_pattern(index, length)
print(dna_pattern)

13 Generate the d-Neighborhood of a String

Generate the d-Neighborhood of a String Find all the neighbors of a pattern.

Given: A DNA string Pattern and an integer d.

Return: The collection of strings Neighbors(Patternd).

13.1 Sample Dataset

ACG
1

13.2 Sample Output

CCG
TCG
GCG
AAG
ATG
AGG
ACA
ACC
ACT
ACG

13.3 Solution

from typing import Set, List, Tuple, Iterator

def calculate_hamming_distance(seq1: str, seq2: str) -> int:
    return sum(base1 != base2 for base1, base2 in zip(seq1, seq2))

def generate_immediate_neighbors(sequence: str) -> Iterator[str]:
    nucleotides = ["A", "T", "G", "C"]
    for i, current_base in enumerate(sequence):
        for new_base in nucleotides:
            if new_base != current_base:
                yield sequence[:i] + new_base + sequence[i + 1:]

def generate_neighbors(sequence: str, max_distance: int) -> Set[str]:
    nucleotides = ["A", "T", "G", "C"]
    if max_distance == 0:
        return {sequence}
    if len(sequence) == 1:
        return set(nucleotides)
    
    neighbors = set()
    suffix_neighbors = generate_neighbors(sequence[1:], max_distance)
    for suffix in suffix_neighbors:
        if calculate_hamming_distance(sequence[1:], suffix) < max_distance:
            neighbors.update(base + suffix for base in nucleotides)
        else:
            neighbors.add(sequence[0] + suffix)
    return neighbors

def parse_input(input_data: str) -> Tuple[str, int]:
    sequence, distance = input_data.strip().split("\n")
    return sequence, int(distance)

sample_input = """
ACG
1
"""

sequence, max_distance = parse_input(sample_input)
neighbor_sequences = generate_neighbors(sequence, max_distance)
print(*sorted(neighbor_sequences), sep="\n")

14 Implement MotifEnumeration

Implanted Motif Problem. Implement MotifEnumeration (shown above) to find all (k, d)-motifs in a collection of strings.

Given: Integers k and d, followed by a collection of strings Dna.

Return: All (kd)-motifs in Dna.

14.1 Sample Dataset

3 1
ATTTGGC
TGCCTTA
CGGTATC
GAAAATT

14.2 Sample Output

ATA ATT GTT TTT

14.3 Solution

from typing import List, Set, Iterator

def calculate_hamming_distance(sequence1: str, sequence2: str) -> int:
    return sum(c1 != c2 for c1, c2 in zip(sequence1, sequence2))

def generate_neighbors(sequence: str, max_distance: int) -> Set[str]:
    nucleotides = ["A", "T", "G", "C"]
    if max_distance == 0:
        return {sequence}
    if len(sequence) == 1:
        return set(nucleotides)
    
    neighbor_set = set()
    for neighbor in generate_neighbors(sequence[1:], max_distance):
        if calculate_hamming_distance(sequence[1:], neighbor) < max_distance:
            for nucleotide in nucleotides:
                neighbor_set.add(nucleotide + neighbor)
        else:
            neighbor_set.add(sequence[0] + neighbor)
    return neighbor_set

def generate_substrings(text: str, substring_length: int) -> Iterator[str]:
    for i in range(len(text) - substring_length + 1):
        yield text[i : i + substring_length]

def get_all_kmers(dna_sequences: List[str], kmer_length: int) -> Set[str]:
    return set(kmer for sequence in dna_sequences for kmer in generate_substrings(sequence, kmer_length))

def contains_approximate_match(pattern: str, text: str, max_distance: int) -> bool:
    return any(calculate_hamming_distance(substring, pattern) <= max_distance 
               for substring in generate_substrings(text, len(pattern)))

def enumerate_motifs(dna_sequences: List[str], kmer_length: int, max_distance: int) -> Set[str]:
    motif_patterns = set()
    for kmer in get_all_kmers(dna_sequences, kmer_length):
        for neighbor_kmer in generate_neighbors(kmer, max_distance):
            if all(contains_approximate_match(neighbor_kmer, sequence, max_distance) for sequence in dna_sequences):
                motif_patterns.add(neighbor_kmer)
    return motif_patterns

# Sample input
sample_input = """
3 1
ATTTGGC
TGCCTTA
CGGTATC
GAAAATT
"""

input_params, *dna_sequences = sample_input.strip().split("\n")
kmer_length, max_distance = map(int, input_params.split())
print(*sorted(enumerate_motifs(dna_sequences, kmer_length, max_distance)))

15 Find a Median String

Median String Problem, Find a median string.

Given: An integer k and a collection of strings Dna.

Return: A k-mer Pattern that minimizes d(PatternDna) over all k-mers Pattern. (If multiple answers exist, you may return any one.)

15.1 Sample Dataset

3
AAATTGACGCAT
GACGACCACGTT
CGTCAGCGCCTG
GCTGAGCACCGG
AGTACGGGACAG

15.2 Sample Output

ACG

15.3 Solution

from typing import Iterator, List
from itertools import product
import math

def generate_substrings(text: str, substring_length: int) -> Iterator[str]:
    for i in range(len(text) - substring_length + 1):
        yield text[i : i + substring_length]

def generate_kmers(kmer_length: int) -> Iterator[str]:
    return ("".join(nucleotides) for nucleotides in product("ACGT", repeat=kmer_length))

def calculate_hamming_distance(sequence1: str, sequence2: str) -> int:
    return sum(nucleotide1 != nucleotide2 for nucleotide1, nucleotide2 in zip(sequence1, sequence2))

def find_minimum_distance(pattern: str, text: str) -> int:
    return min(calculate_hamming_distance(substring, pattern) for substring in generate_substrings(text, len(pattern)))

def calculate_total_distance(pattern: str, dna_sequences: List[str]) -> int:
    return sum(find_minimum_distance(pattern, sequence) for sequence in dna_sequences)

def find_median_string(dna_sequences: List[str], kmer_length: int) -> str:
    min_distance = math.inf
    median_kmer = ""
    
    for kmer in generate_kmers(kmer_length):
        current_distance = calculate_total_distance(kmer, dna_sequences)
        if current_distance < min_distance:
            min_distance = current_distance
            median_kmer = kmer
    
    return median_kmer

# Sample input
sample_input = """
3
AAATTGACGCAT
GACGACCACGTT
CGTCAGCGCCTG
GCTGAGCACCGG
AGTACGGGACAG
"""

kmer_length, *dna_sequences = sample_input.strip().split("\n")
result = find_median_string(dna_sequences, int(kmer_length))
print(result)

16 Find a Profile-most Probable k-mer in a String

Profile-most Probable k-mer Problem, Find a Profile-most probable k-mer in a string.

Given: A string Text, an integer k, and a 4 × k matrix Profile.

Return: A Profile-most probable k-mer in Text. (If multiple answers exist, you may return any one.)

16.1 Sample Dataset

ACCTGTTTATTGCCTAAGTTCCGAACAAACCCAATATAGCCCGAGGGCCT
5
0.2 0.2 0.3 0.2 0.3
0.4 0.3 0.1 0.5 0.1
0.3 0.3 0.5 0.2 0.4
0.1 0.2 0.1 0.1 0.2

16.2 Sample Output

CCGAG

16.3 Solution

from typing import Iterator, List
import math

def generate_substrings(text: str, substring_length: int) -> Iterator[str]:
    for i in range(len(text) - substring_length + 1):
        yield text[i : i + substring_length]

def find_profile_most_probable_kmer(sequence: str, kmer_length: int, profile_matrix: List[List[float]]) -> str:
    nucleotide_index = {"A": 0, "C": 1, "G": 2, "T": 3}
    max_probability = -1
    most_probable_kmer = ""

    for kmer in generate_substrings(sequence, kmer_length):
        kmer_probability = math.prod(profile_matrix[nucleotide_index[kmer[j]]][j] for j in range(kmer_length))
        if kmer_probability > max_probability:
            max_probability = kmer_probability
            most_probable_kmer = kmer

    return most_probable_kmer

# Sample input
sample_input = """
ACCTGTTTATTGCCTAAGTTCCGAACAAACCCAATATAGCCCGAGGGCCT
5
0.2 0.2 0.3 0.2 0.3
0.4 0.3 0.1 0.5 0.1
0.3 0.3 0.5 0.2 0.4
0.1 0.2 0.1 0.1 0.2
"""

dna_sequence, kmer_length, *profile_rows = sample_input.strip().split("\n")
profile_matrix = [list(map(float, row.split())) for row in profile_rows]
result = find_profile_most_probable_kmer(dna_sequence, int(kmer_length), profile_matrix)
print(result)

17 Implement GreedyMotifSearch

Implement, GreedyMotifSearch.

Given: Integers k and t, followed by a collection of strings Dna.

Return: A collection of strings BestMotifs resulting from running GreedyMotifSearch(Dnakt). If at any step you find more than one Profile-most probable k-mer in a given string, use the one occurring first.

17.1 Sample Dataset

3 5
GGCGTTCAGGCA
AAGAATCAGTCA
CAAGGAGTTCGC
CACGTCAATCAC
CAATAATATTCG

17.2 Sample Output

CAG
CAG
CAA
CAA
CAA

17.3 Solution

from typing import Iterator, List, Dict
from collections import Counter
import math

def generate_kmers(sequence: str, kmer_length: int) -> Iterator[str]:
    for i in range(len(sequence) - kmer_length + 1):
        yield sequence[i : i + kmer_length]

def find_most_probable_kmer(sequence: str, kmer_length: int, profile: List[List[float]]) -> str:
    nucleotide_to_index: Dict[str, int] = {"A": 0, "C": 1, "G": 2, "T": 3}
    max_probability: float = -1
    most_probable_kmer: str = ""

    for kmer in generate_kmers(sequence, kmer_length):
        kmer_probability: float = math.prod(profile[nucleotide_to_index[kmer[j]]][j] for j in range(kmer_length))
        if kmer_probability > max_probability:
            max_probability = kmer_probability
            most_probable_kmer = kmer

    return most_probable_kmer

def create_profile(sequences: List[str], pseudocount: int = 0) -> List[List[float]]:
    nucleotides: List[str] = ["A", "C", "G", "T"]
    profile: List[List[float]] = [[] for _ in nucleotides]
    for i, nucleotide in enumerate(nucleotides):
        profile[i] = [
            (sum(seq[j] == nucleotide for seq in sequences) + pseudocount) / len(sequences)
            for j in range(len(sequences[0]))
        ]
    return profile

def calculate_score(motifs: List[str]) -> int:
    score: int = 0
    for i in range(len(motifs[0])):
        column: List[str] = [motif[i] for motif in motifs]
        most_common: str = Counter(column).most_common()[0][0]
        score += sum(nucleotide != most_common for nucleotide in column)
    return score

def greedy_motif_search(dna_sequences: List[str], kmer_length: int, pseudocount: int = 0) -> List[str]:
    best_motifs: List[str] = [seq[:kmer_length] for seq in dna_sequences]
    for kmer in generate_kmers(dna_sequences[0], kmer_length):
        current_motifs: List[str] = [kmer]
        for i in range(1, len(dna_sequences)):
            current_profile: List[List[float]] = create_profile(current_motifs, pseudocount=pseudocount)
            current_motifs.append(find_most_probable_kmer(dna_sequences[i], kmer_length, current_profile))
        if calculate_score(current_motifs) < calculate_score(best_motifs):
            best_motifs = current_motifs
    return best_motifs

# Sample input
sample_input: str = """
3 5
GGCGTTCAGGCA
AAGAATCAGTCA
CAAGGAGTTCGC
CACGTCAATCAC
CAATAATATTCG
"""

ints, *dna = sample_input.strip().split("\n")
k, t = map(int, ints.split())
result: List[str] = greedy_motif_search(dna, k)
print(*result, sep="\n")

18 Implement GreedyMotifSearch with Pseudocounts

Implement. GreedyMotifSearch with Pseudocounts.

Given: Integers k and t, followed by a collection of strings Dna.

Return: A collection of strings BestMotifs resulting from running GreedyMotifSearch(Dnakt) with pseudocounts. If at any step you find more than one Profile-most probable k-mer in a given string, use the one occurring first.

18.1 Sample Dataset

3 5
GGCGTTCAGGCA
AAGAATCAGTCA
CAAGGAGTTCGC
CACGTCAATCAC
CAATAATATTCG

18.2 Sample Output

TTC
ATC
TTC
ATC
TTC

18.3 Solution

from typing import Iterator, List, Dict
from collections import Counter
import math

def generate_kmers(sequence: str, kmer_length: int) -> Iterator[str]:
    for i in range(len(sequence) - kmer_length + 1):
        yield sequence[i : i + kmer_length]

def find_most_probable_kmer(sequence: str, kmer_length: int, profile: List[List[float]]) -> str:
    nucleotide_to_index: Dict[str, int] = {"A": 0, "C": 1, "G": 2, "T": 3}
    return max(
        generate_kmers(sequence, kmer_length),
        key=lambda kmer: math.prod(profile[nucleotide_to_index[nucleotide]][position] 
                                   for position, nucleotide in enumerate(kmer))
    )

def create_profile(motifs: List[str], pseudocount: int = 0) -> List[List[float]]:
    nucleotides: List[str] = ["A", "C", "G", "T"]
    motif_count: int = len(motifs)
    motif_length: int = len(motifs[0])
    
    return [
        [(sum(motif[position] == nucleotide for motif in motifs) + pseudocount) / motif_count 
         for position in range(motif_length)]
        for nucleotide in nucleotides
    ]

def calculate_score(motifs: List[str]) -> int:
    return sum(
        sum(nucleotide != Counter(column).most_common(1)[0][0] for nucleotide in column)
        for column in zip(*motifs)
    )

def greedy_motif_search(dna_sequences: List[str], kmer_length: int, pseudocount: int = 0) -> List[str]:
    best_motifs: List[str] = [sequence[:kmer_length] for sequence in dna_sequences]
    
    for kmer in generate_kmers(dna_sequences[0], kmer_length):
        current_motifs: List[str] = [kmer]
        for sequence in dna_sequences[1:]:
            profile: List[List[float]] = create_profile(current_motifs, pseudocount)
            current_motifs.append(find_most_probable_kmer(sequence, kmer_length, profile))
        
        if calculate_score(current_motifs) < calculate_score(best_motifs):
            best_motifs = current_motifs
    
    return best_motifs

# Sample input
sample_input: str = """
3 5
GGCGTTCAGGCA
AAGAATCAGTCA
CAAGGAGTTCGC
CACGTCAATCAC
CAATAATATTCG
"""

k_value, _, *dna_sequences = sample_input.strip().split()
k_value = int(k_value)
result: List[str] = greedy_motif_search(dna_sequences, k_value, pseudocount=1)
print(*result, sep="\n")

19 Implement RandomizedMotifSearch

Implement RandomizedMotifSearch.

Given: Positive integers k and t, followed by a collection of strings Dna.

Return: A collection BestMotifs resulting from running RandomizedMotifSearch(Dnakt) 1000 times. Remember to use pseudocounts!

19.1 Sample Dataset

8 5
CGCCCCTCTCGGGGGTGTTCAGTAAACGGCCA
GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG
TAGTACCGAGACCGAAAGAAGTATACAGGCGT
TAGATCAAGTTTCAGGTGCACGTCGGTGAACC
AATCCACCAGCTCCACGTGCAATGTTGGCCTA

19.2 Sample Output

AACGGCCA
AAGTGCCA
TAGTACCG
AAGTTTCA
ACGTGCAA

19.3 Solution

from typing import List, Tuple, Callable
from collections import Counter
from random import randint
import math

def generate_kmers(sequence: str, kmer_length: int) -> List[str]:
    return [sequence[i:i+kmer_length] for i in range(len(sequence) - kmer_length + 1)]

def find_most_probable_kmer(sequence: str, kmer_length: int, profile: List[List[float]]) -> str:
    nucleotide_to_index = {"A": 0, "C": 1, "G": 2, "T": 3}
    return max(
        generate_kmers(sequence, kmer_length),
        key=lambda kmer: math.prod(profile[nucleotide_to_index[nucleotide]][j] for j, nucleotide in enumerate(kmer))
    )

def create_profile(motifs: List[str], pseudocount: int = 0) -> List[List[float]]:
    nucleotides = ["A", "C", "G", "T"]
    profile = []
    for nucleotide in nucleotides:
        profile.append([
            (sum(seq[j] == nucleotide for seq in motifs) + pseudocount) / (len(motifs) + 4 * pseudocount)
            for j in range(len(motifs[0]))
        ])
    return profile

def calculate_score(motifs: List[str]) -> int:
    return sum(
        sum(nucleotide != Counter(column).most_common(1)[0][0] for nucleotide in column)
        for column in zip(*motifs)
    )

def generate_random_kmer(sequence: str, kmer_length: int) -> str:
    start = randint(0, len(sequence) - kmer_length)
    return sequence[start : start + kmer_length]

def find_motifs(profile: List[List[float]], dna_sequences: List[str]) -> List[str]:
    kmer_length = len(profile[0])
    return [find_most_probable_kmer(seq, kmer_length, profile) for seq in dna_sequences]

def randomized_motif_search(dna_sequences: List[str], kmer_length: int) -> Tuple[int, List[str]]:
    motifs = [generate_random_kmer(seq, kmer_length) for seq in dna_sequences]
    best_score = math.inf
    
    while True:
        profile = create_profile(motifs, pseudocount=1)
        motifs = find_motifs(profile, dna_sequences)
        current_score = calculate_score(motifs)
        
        if current_score >= best_score:
            return best_score, motifs
        
        best_score = current_score

def find_best_motifs(search_function: Callable, iterations: int, *args) -> List[str]:
    best_score, best_motifs = search_function(*args)
    
    for _ in range(iterations - 1):
        score, motifs = search_function(*args)
        if score < best_score:
            best_score, best_motifs = score, motifs
    
    return best_motifs

# Sample input
sample_input = """
8 5
CGCCCCTCTCGGGGGTGTTCAGTAAACGGCCA
GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG
TAGTACCGAGACCGAAAGAAGTATACAGGCGT
TAGATCAAGTTTCAGGTGCACGTCGGTGAACC
AATCCACCAGCTCCACGTGCAATGTTGGCCTA
"""

kmer_length, _, *dna_sequences = sample_input.strip().split()
kmer_length = int(kmer_length)

result = find_best_motifs(randomized_motif_search, 1000, dna_sequences, kmer_length)
print(*result, sep="\n")

20 Implement GibbsSampler

Implement, GibbsSampler.

Given: Integers kt, and N, followed by a collection of strings Dna.

Return: The strings BestMotifs resulting from running GibbsSampler(DnaktN) with 20 random starts. Remember to use pseudocounts!

20.1 Sample Dataset

8 5 100
CGCCCCTCTCGGGGGTGTTCAGTAAACGGCCA
GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG
TAGTACCGAGACCGAAAGAAGTATACAGGCGT
TAGATCAAGTTTCAGGTGCACGTCGGTGAACC
AATCCACCAGCTCCACGTGCAATGTTGGCCTA

20.2 Sample Output

TCTCGGGG
CCAAGGTG
TACAGGCG
TTCAGGTG
TCCACGTG

20.3 Solution

from typing import List, Iterator, Tuple, Callable
from collections import Counter
import math
import random

def generate_kmers(sequence: str, kmer_length: int) -> Iterator[str]:
    for i in range(len(sequence) - kmer_length + 1):
        yield sequence[i : i + kmer_length]

def create_profile(motifs: List[str], pseudocount: int = 0) -> List[List[float]]:
    nucleotides: List[str] = ["A", "C", "G", "T"]
    motif_count: int = len(motifs)
    motif_length: int = len(motifs[0])
    
    return [
        [(sum(motif[position] == nucleotide for motif in motifs) + pseudocount) / (motif_count + 4*pseudocount)
         for position in range(motif_length)]
        for nucleotide in nucleotides
    ]

def calculate_score(motifs: List[str]) -> int:
    return sum(
        sum(nucleotide != Counter(column).most_common(1)[0][0] for nucleotide in column)
        for column in zip(*motifs)
    )

def generate_random_kmer(sequence: str, kmer_length: int) -> str:
    start_index = random.randint(0, len(sequence) - kmer_length)
    return sequence[start_index : start_index + kmer_length]

def find_best_motifs(search_function: Callable, iterations: int, *args) -> List[str]:
    best_score, best_motifs = search_function(*args)
    for _ in range(iterations - 1):
        score, motifs = search_function(*args)
        if score < best_score:
            best_score, best_motifs = score, motifs
    return best_motifs

def calculate_kmer_probabilities(sequence: str, kmer_length: int, profile: List[List[float]]) -> List[float]:
    nucleotide_to_index: Dict[str, int] = {"A": 0, "C": 1, "G": 2, "T": 3}
    return [
        math.prod(profile[nucleotide_to_index[kmer[j]]][j] for j in range(kmer_length))
        for kmer in generate_kmers(sequence, kmer_length)
    ]

def select_random_kmer(sequence: str, kmer_length: int, profile: List[List[float]]) -> str:
    probabilities = calculate_kmer_probabilities(sequence, kmer_length, profile)
    start_index = random.choices(range(len(probabilities)), probabilities)[0]
    return sequence[start_index : start_index + kmer_length]

def gibbs_sampler(dna_sequences: List[str], kmer_length: int, num_iterations: int) -> Tuple[int, List[str]]:
    motifs = [generate_random_kmer(seq, kmer_length) for seq in dna_sequences]
    best_motifs = motifs.copy()
    for _ in range(num_iterations):
        i = random.randint(0, len(dna_sequences) - 1)
        profile = create_profile(motifs[:i] + motifs[i + 1 :], pseudocount=1)
        motifs[i] = select_random_kmer(dna_sequences[i], kmer_length, profile)
        if calculate_score(motifs) < calculate_score(best_motifs):
            best_motifs = motifs.copy()
    return calculate_score(best_motifs), best_motifs

# Sample input
sample_input = """
8 5 100
TCTCGGGG
CCAAGGTG
TACAGGCG
TTCAGGTG
TCCACGTG
"""

kmer_length, num_sequences, num_iterations, *dna_sequences = sample_input.strip().split()
kmer_length = int(kmer_length)
num_iterations = int(num_iterations)
result = find_best_motifs(gibbs_sampler, 20, dna_sequences, kmer_length, num_iterations)
print(*result, sep="\n")

21 Implement DistanceBetweenPatternAndStrings

Compute DistanceBetweenPatternAndStrings. Find the distance between a pattern and a set of strings..

Given: A DNA string Pattern and a collection of DNA strings Dna.

Return: DistanceBetweenPatternAndStrings(PatternDna).

21.1 Sample Dataset

AAA
TTACCTTAAC GATATCTGTC ACGGCGTTCG CCCTAAAGAG CGTCAGAGGT

21.2 Sample Output

5

21.3 Solution

from typing import List, Iterator
import math

def generate_kmers(sequence: str, kmer_length: int) -> Iterator[str]:
    for i in range(len(sequence) - kmer_length + 1):
        yield sequence[i : i + kmer_length]

def calculate_hamming_distance(seq1: str, seq2: str) -> int:
    return sum(base1 != base2 for base1, base2 in zip(seq1, seq2))

def find_minimum_distance(pattern: str, text: str) -> int:
    return min(calculate_hamming_distance(kmer, pattern) for kmer in generate_kmers(text, len(pattern)))

def calculate_pattern_distance_to_strings(pattern: str, dna_strings: List[str]) -> int:
    return sum(find_minimum_distance(pattern, dna_string) for dna_string in dna_strings)

# Sample input
sample_input = """
AAA
TTACCTTAAC GATATCTGTC ACGGCGTTCG CCCTAAAGAG CGTCAGAGGT
"""

pattern, dna_strings_raw = sample_input.strip().split("\n")
dna_strings = dna_strings_raw.split()

result = calculate_pattern_distance_to_strings(pattern, dna_strings)
print(result)

22 Generate the k-mer Composition of a String

String Composition Problem, Generate the k-mer composition of a string.

Given: An integer k and a string Text.

Return: *Composition__k(Text) (the k*-mers can be provided in any order).

22.1 Sample Dataset

5
CAATCCAAC

22.2 Sample Output

CAATC
AATCC
ATCCA
TCCAA
CCAAC

22.3 Solution

from typing import Iterator

def generate_kmers(sequence: str, kmer_length: int) -> Iterator[str]:
    for i in range(len(sequence) - kmer_length + 1):
        yield sequence[i:i + kmer_length]

sample_input: str = """
5
CAATCCAAC
"""

input_lines: list[str] = sample_input.strip().split("\n")
kmer_length: int = int(input_lines[0])
dna_sequence: str = input_lines[1]

for kmer in generate_kmers(dna_sequence, kmer_length):
    print(kmer)

23 Reconstruct a String from its Genome Path

String Spelled by a Genome Path Problem, Find the string spelled by a genome path.

Given: A sequence of k-mers Pattern1,…, Patternn such that the last k - 1 symbols of Patterni are equal to the first k - 1 symbols of Patterni+1 for i from 1 to n-1.

Return: A string Text of length k+n-1 where the i-th k-mer in Text is equal to Patterni for all i.

23.1 Sample Dataset

ACCGA
CCGAA
CGAAG
GAAGC
AAGCT

23.2 Sample Output

ACCGAAGCT

23.3 Solution

from typing import List

def reconstruct_dna_sequence(kmers: List[str]) -> str:
    reconstructed_sequence: str = kmers[0]
    for i in range(1, len(kmers)):
        reconstructed_sequence += kmers[i][-1]
    return reconstructed_sequence

sample_input: str = """
ACCGA
CCGAA
CGAAG
GAAGC
AAGCT
"""

kmer_list: List[str] = sample_input.strip().split("\n")
print(reconstruct_dna_sequence(kmer_list))

24 Construct the Overlap Graph of a Collection of k-mers

Overlap Graph Problem, Construct the overlap graph of a collection of k-mers.

Given: A collection Patterns of k-mers.

Return: The overlap graph Overlap(Patterns), in the form of an adjacency list.

24.1 Sample Dataset

ATGCG
GCATG
CATGC
AGGCA
GGCAT

24.2 Sample Output

GCATG -> CATGC
CATGC -> ATGCG
AGGCA -> GGCAT
GGCAT -> GCATG

24.3 Solution

from typing import List

def overlap_graph(patterns: List[str]) -> List[tuple[str, str]]:
    adj_list = []
    for i in range(len(patterns)):
        for j in range(len(patterns)):
            if i != j and patterns[i][1:] == patterns[j][:-1]:
                adj_list.append((patterns[i], patterns[j]))
    return adj_list

sample_input = """
ATGCG
GCATG
CATGC
AGGCA
GGCAT
"""

Patterns: List[str] = sample_input.strip().split("\n")

adj_list = overlap_graph(Patterns)
for edge in adj_list:
    print(f"{edge[0]} -> {edge[1]}")

25 Construct the De Bruijn Graph of a String

De Bruijn Graph from a String Problem. Construct the de Bruijn graph of a string.

Given: An integer k and a string Text.

Return:*DeBruijn__k(Text*), in the form of an adjacency list.

25.1 Sample Dataset

4
AAGATTCTCTAC

25.2 Sample Output

AAG -> AGA
AGA -> GAT
ATT -> TTC
CTA -> TAC
CTC -> TCT
GAT -> ATT
TCT -> CTA,CTC
TTC -> TCT

25.3 Solution

from collections import OrderedDict
from typing import List, Set, OrderedDict as OrderedDictType

def construct_de_bruijn_graph(sequence: str, kmer_length: int) -> OrderedDictType[str, Set[str]]:
    adjacency_list: OrderedDictType[str, Set[str]] = OrderedDict()
    
    for i in range(len(sequence) - kmer_length + 2):
        adjacency_list[sequence[i:i + kmer_length - 1]] = set()

    for i in range(len(sequence) - kmer_length + 1):
        prefix = sequence[i:i + kmer_length - 1]
        suffix = sequence[i + 1:i + kmer_length]
        adjacency_list[prefix].add(suffix)

    return adjacency_list

sample_input: str = """
4
AAGATTCTCTAC
"""

input_lines: List[str] = sample_input.strip().split("\n")
kmer_length: int = int(input_lines[0])
dna_sequence: str = input_lines[1]

adjacency_list = construct_de_bruijn_graph(dna_sequence, kmer_length)
for node, neighbors in adjacency_list.items():
    if neighbors:
        print(f"{node} -> {','.join(neighbors)}")

26 Construct the De Bruijn Graph of a Collection of k-mers

De Bruijn Graph from k-mers Problem. Construct the de Bruijn graph from a collection of k-mers.

Given: A collection of k-mers Patterns.

Return: The de Bruijn graph DeBruijn(Patterns), in the form of an adjacency list.

26.1 Sample Dataset

GAGG
CAGG
GGGG
GGGA
CAGG
AGGG
GGAG

26.2 Sample Output

GAG -> AGG
CAG -> AGG,AGG
GGG -> GGG,GGA
AGG -> GGG
GGA -> GAG

26.3 Solution

from typing import List, Dict

def construct_de_bruijn_graph(kmers: List[str]) -> Dict[str, List[str]]:
    adjacency_list: Dict[str, List[str]] = {}
    for kmer in kmers:
        prefix = kmer[:-1]
        suffix = kmer[1:]
        if prefix not in adjacency_list:
            adjacency_list[prefix] = [suffix]
        else:
            adjacency_list[prefix].append(suffix)
    return adjacency_list

sample_input: str = """
GAGG
CAGG
GGGG
GGGA
CAGG
AGGG
GGAG
"""

kmer_list: List[str] = sample_input.strip().split("\n")

adjacency_list = construct_de_bruijn_graph(kmer_list)
for node, neighbors in adjacency_list.items():
    print(f"{node} -> {','.join(neighbors)}")

27 Find an Eulerian Cycle in a Graph

Eulerian Cycle Problem, Find an Eulerian cycle in a graph.

Given: An Eulerian directed graph, in the form of an adjacency list.

Return: An Eulerian cycle in this graph.

27.1 Sample Dataset

0 -> 3
1 -> 0
2 -> 1,6
3 -> 2
4 -> 2
5 -> 4
6 -> 5,8
7 -> 9
8 -> 7
9 -> 6

27.2 Sample Output

6->8->7->9->6->5->4->2->1->0->3->2->6

27.3 Solution

from re import split
from random import choice
from typing import Dict, List, Tuple

def parse_adjacency_list(adjacency_list_text: List[str]) -> Dict[str, List[str]]:
    adjacency_dict: Dict[str, List[str]] = {}
    for element in adjacency_list_text:
        node, neighbors = split(' -> ', element)
        adjacency_dict[node] = neighbors.split(',')
    return adjacency_dict

def remove_edge(graph: Dict[str, List[str]], source: str, target: str) -> Dict[str, List[str]]:
    graph[source].remove(target)
    if not graph[source]:
        del graph[source]
    return graph

def find_eulerian_cycle(graph: Dict[str, List[str]]) -> List[str]:
    # Form a cycle by randomly walking in the graph
    start_node, edges = choice(list(graph.items()))
    next_node = choice(edges)
    graph = remove_edge(graph, start_node, next_node)

    cycle: List[str] = [start_node, next_node]
    current_node = next_node
    while current_node != start_node:
        edges = graph[current_node]
        next_node = choice(edges)
        graph = remove_edge(graph, current_node, next_node)
        current_node = next_node
        cycle.append(current_node)

    while graph:
        potential_starts: List[Tuple[int, str]] = [(idx, node) for idx, node in enumerate(cycle) if node in graph]
        idx, new_start = choice(potential_starts)

        # Form new_cycle by traversing cycle (starting at new_start) and then randomly walking
        new_cycle = cycle[idx:] + cycle[1:idx + 1]

        next_node = choice(graph[new_start])
        graph = remove_edge(graph, new_start, next_node)
        current_node = next_node
        new_cycle.append(current_node)
        while current_node != new_start:
            edges = graph[current_node]
            next_node = choice(edges)
            graph = remove_edge(graph, current_node, next_node)
            current_node = next_node
            new_cycle.append(current_node)
        cycle = new_cycle
    return cycle

sample_input: str = """
0 -> 3
1 -> 0
2 -> 1,6
3 -> 2
4 -> 2
5 -> 4
6 -> 5,8
7 -> 9
8 -> 7
9 -> 6
"""

input_lines: List[str] = sample_input.strip().split("\n")
adjacency_list = parse_adjacency_list(input_lines)

print("->".join(find_eulerian_cycle(adjacency_list)))

28 Find an Eulerian Path in a Graph

Eulerian Path Problem, Find an Eulerian path in a graph.

Given: A directed graph that contains an Eulerian path, where the graph is given in the form of an adjacency list.

Return: An Eulerian path in this graph.

28.1 Sample Dataset

0 -> 2
1 -> 3
2 -> 1
3 -> 0,4
6 -> 3,7
7 -> 8
8 -> 9
9 -> 6

28.2 Sample Output

6->7->8->9->6->3->0->2->1->3->4

28.3 Solution

from re import split
from random import choice
from typing import Dict, List, Tuple

def parse_adjacency_list(adjacency_text: List[str]) -> Dict[str, List[str]]:
    adjacency_dict: Dict[str, List[str]] = {}
    for line in adjacency_text:
        node, neighbors = split(' -> ', line)
        adjacency_dict[node] = neighbors.split(',')
    return adjacency_dict

def remove_edge(graph: Dict[str, List[str]], source: str, target: str) -> Dict[str, List[str]]:
    graph[source].remove(target)
    if not graph[source]:
        del graph[source]
    return graph

def find_eulerian_cycle(graph: Dict[str, List[str]]) -> List[str]:
    start_node, edges = choice(list(graph.items()))
    next_node = choice(edges)
    graph = remove_edge(graph, start_node, next_node)

    cycle: List[str] = [start_node, next_node]
    current_node = next_node
    while current_node != start_node:
        edges = graph[current_node]
        next_node = choice(edges)
        graph = remove_edge(graph, current_node, next_node)
        current_node = next_node
        cycle.append(current_node)

    while graph:
        potential_starts: List[Tuple[int, str]] = [(idx, node) for idx, node in enumerate(cycle) if node in graph]
        idx, new_start = choice(potential_starts)

        new_cycle = cycle[idx:] + cycle[1:idx + 1]

        next_node = choice(graph[new_start])
        graph = remove_edge(graph, new_start, next_node)
        current_node = next_node
        new_cycle.append(current_node)
        while current_node != new_start:
            edges = graph[current_node]
            next_node = choice(edges)
            graph = remove_edge(graph, current_node, next_node)
            current_node = next_node
            new_cycle.append(current_node)
        cycle = new_cycle
    return cycle

def find_eulerian_path(graph: Dict[str, List[str]]) -> List[str]:
    degree_differences: Dict[str, int] = {}
    for source, targets in graph.items():
        degree_differences[source] = degree_differences.get(source, 0) + len(targets)
        for target in targets:
            degree_differences[target] = degree_differences.get(target, 0) - 1

    start_node = [node for node, diff in degree_differences.items() if diff == -1][0]
    end_node = [node for node, diff in degree_differences.items() if diff == 1][0]
    
    if start_node in graph:
        graph[start_node].append(end_node)
    else:
        graph[start_node] = [end_node]

    cycle = find_eulerian_cycle(graph)
    for idx, node in enumerate(cycle):
        if node == start_node and cycle[(idx + 1) % len(cycle)] == end_node:
            return cycle[idx + 1:] + cycle[1:idx + 1]

    return cycle  # This should never happen if the input is valid

sample_input: str = """
0 -> 2
1 -> 3
2 -> 1
3 -> 0,4
6 -> 3,7
7 -> 8
8 -> 9
9 -> 6
"""

input_lines: List[str] = sample_input.strip().split("\n")
adjacency_list = parse_adjacency_list(input_lines)

print("->".join(find_eulerian_path(adjacency_list)))

29 Reconstruct a String from its k-mer Composition

String Reconstruction Problem. Reconstruct a string from its k-mer composition.

Given: An integer k followed by a list of k-mers Patterns.

Return: A string Text with k-mer composition equal to Patterns. (If multiple answers exist, you may return any one.)

29.1 Sample Dataset

4
CTTA
ACCA
TACC
GGCT
GCTT
TTAC

29.2 Sample Output

GGCTTACCA

29.3 Solution

from typing import List, Dict, Tuple
from random import choice

def construct_de_bruijn_graph(kmers: List[str]) -> Dict[str, List[str]]:
    adjacency_dict: Dict[str, List[str]] = {}
    for kmer in kmers:
        prefix = kmer[:-1]
        suffix = kmer[1:]
        if prefix not in adjacency_dict:
            adjacency_dict[prefix] = [suffix]
        else:
            adjacency_dict[prefix].append(suffix)
    return adjacency_dict

def remove_edge(graph: Dict[str, List[str]], source: str, target: str) -> Dict[str, List[str]]:
    graph[source].remove(target)
    if not graph[source]:
        del graph[source]
    return graph

def find_eulerian_cycle(graph: Dict[str, List[str]]) -> List[str]:
    start_node, edges = choice(list(graph.items()))
    next_node = choice(edges)
    graph = remove_edge(graph, start_node, next_node)

    cycle: List[str] = [start_node, next_node]
    current_node = next_node
    while current_node != start_node:
        edges = graph[current_node]
        next_node = choice(edges)
        graph = remove_edge(graph, current_node, next_node)
        current_node = next_node
        cycle.append(current_node)

    while graph:
        potential_starts: List[Tuple[int, str]] = [(idx, node) for idx, node in enumerate(cycle) if node in graph]
        idx, new_start = choice(potential_starts)

        new_cycle = cycle[idx:] + cycle[1:idx + 1]

        next_node = choice(graph[new_start])
        graph = remove_edge(graph, new_start, next_node)
        current_node = next_node
        new_cycle.append(current_node)
        while current_node != new_start:
            edges = graph[current_node]
            next_node = choice(edges)
            graph = remove_edge(graph, current_node, next_node)
            current_node = next_node
            new_cycle.append(current_node)
        cycle = new_cycle
    return cycle

def find_eulerian_path(graph: Dict[str, List[str]]) -> List[str]:
    degree_differences: Dict[str, int] = {}
    for source, targets in graph.items():
        degree_differences[source] = degree_differences.get(source, 0) + len(targets)
        for target in targets:
            degree_differences[target] = degree_differences.get(target, 0) - 1

    start_node = [node for node, diff in degree_differences.items() if diff == -1][0]
    end_node = [node for node, diff in degree_differences.items() if diff == 1][0]
    
    if start_node in graph:
        graph[start_node].append(end_node)
    else:
        graph[start_node] = [end_node]

    cycle = find_eulerian_cycle(graph)
    for idx, node in enumerate(cycle):
        if node == start_node and cycle[(idx + 1) % len(cycle)] == end_node:
            return cycle[idx + 1:] + cycle[1:idx + 1]

    return cycle  # This should never happen if the input is valid

def reconstruct_string(kmers: List[str]) -> str:
    adjacency_list = construct_de_bruijn_graph(kmers)
    path = find_eulerian_path(adjacency_list)
    reconstructed_string = path[0][:-1]
    for node in path:
        reconstructed_string += node[-1]
    return reconstructed_string

sample_input: str = """
4
CTTA
ACCA
TACC
GGCT
GCTT
TTAC
"""

input_lines: List[str] = sample_input.strip().split("\n")
k: int = int(input_lines[0])
kmers: List[str] = input_lines[1:]

print(reconstruct_string(kmers))

30 Find a k-Universal Circular String

k-Universal Circular String Problem. Find a k-universal circular binary string.

Given: An integer k.

Return: A k-universal circular string. (If multiple answers exist, you may return any one.)

30.1 Sample Dataset

4

30.2 Sample Output

1111010010110000

30.3 Solution

from typing import List, Dict, Tuple
from random import choice

def construct_de_bruijn_graph(kmers: List[str]) -> Dict[str, List[str]]:
    adjacency_dict: Dict[str, List[str]] = {}
    for kmer in kmers:
        prefix = kmer[:-1]
        suffix = kmer[1:]
        if prefix not in adjacency_dict:
            adjacency_dict[prefix] = [suffix]
        else:
            adjacency_dict[prefix].append(suffix)
    return adjacency_dict

def remove_edge(graph: Dict[str, List[str]], source: str, target: str) -> Dict[str, List[str]]:
    graph[source].remove(target)
    if not graph[source]:
        del graph[source]
    return graph

def find_eulerian_cycle(graph: Dict[str, List[str]]) -> List[str]:
    start_node, edges = choice(list(graph.items()))
    next_node = choice(edges)
    graph = remove_edge(graph, start_node, next_node)

    cycle: List[str] = [start_node, next_node]
    current_node = next_node
    while current_node != start_node:
        edges = graph[current_node]
        next_node = choice(edges)
        graph = remove_edge(graph, current_node, next_node)
        current_node = next_node
        cycle.append(current_node)

    while graph:
        potential_starts: List[Tuple[int, str]] = [(idx, node) for idx, node in enumerate(cycle) if node in graph]
        idx, new_start = choice(potential_starts)

        new_cycle = cycle[idx:] + cycle[1:idx + 1]

        next_node = choice(graph[new_start])
        graph = remove_edge(graph, new_start, next_node)
        current_node = next_node
        new_cycle.append(current_node)
        while current_node != new_start:
            edges = graph[current_node]
            next_node = choice(edges)
            graph = remove_edge(graph, current_node, next_node)
            current_node = next_node
            new_cycle.append(current_node)
        cycle = new_cycle
    return cycle

def generate_k_universal_circular_string(k: int) -> str:
    kmers: List[str] = []
    for i in range(2 ** k):
        kmer = format(i, f'0{k}b')
        kmers.append(kmer)

    adjacency_list = construct_de_bruijn_graph(kmers)
    cycle = find_eulerian_cycle(adjacency_list)

    cycle = cycle[:len(cycle) - k + 1]
    circular_string = cycle[0][:-1]
    for node in cycle:
        circular_string += node[-1]
    return circular_string

sample_input: str = """
4
"""

input_lines: List[str] = sample_input.strip().split("\n")
k: int = int(input_lines[0])

print(generate_k_universal_circular_string(k))

31 Reconstruct a String from its Paired Composition

String Reconstruction from Read-Pairs Problem. Reconstruct a string from its paired composition.

Given: Integers k and d followed by a collection of paired k-mers PairedReads.

Return: A string Text with (kd)-mer composition equal to PairedReads. (If multiple answers exist, you may return any one.)

31.1 Sample Dataset

4 2
GAGA|TTGA
TCGT|GATG
CGTG|ATGT
TGGT|TGAG
GTGA|TGTT
GTGG|GTGA
TGAG|GTTG
GGTC|GAGA
GTCG|AGAT

31.2 Sample Output

GTGGTCGTGAGATGTTGA

31.3 Solution

import sys
from collections import defaultdict
from typing import List, Tuple, Dict
from random import choice

def remove_edge(graph: Dict[str, List[str]], source: str, target: str) -> Dict[str, List[str]]:
    graph[source].remove(target)
    if not graph[source]:
        del graph[source]
    return graph

def find_eulerian_cycle(graph: Dict[str, List[str]]) -> List[str]:
    start_node, edges = choice(list(graph.items()))
    next_node = choice(edges)
    graph = remove_edge(graph, start_node, next_node)

    cycle: List[str] = [start_node, next_node]
    current_node = next_node
    while current_node != start_node:
        edges = graph[current_node]
        next_node = choice(edges)
        graph = remove_edge(graph, current_node, next_node)
        current_node = next_node
        cycle.append(current_node)

    while graph:
        potential_starts: List[Tuple[int, str]] = [(idx, node) for idx, node in enumerate(cycle) if node in graph]
        idx, new_start = choice(potential_starts)

        new_cycle = cycle[idx:] + cycle[1:idx + 1]

        next_node = choice(graph[new_start])
        graph = remove_edge(graph, new_start, next_node)
        current_node = next_node
        new_cycle.append(current_node)
        while current_node != new_start:
            edges = graph[current_node]
            next_node = choice(edges)
            graph = remove_edge(graph, current_node, next_node)
            current_node = next_node
            new_cycle.append(current_node)
        cycle = new_cycle
    return cycle

def find_eulerian_path(graph: Dict[str, List[str]]) -> List[str]:
    degree_differences: Dict[str, int] = {}
    for source, targets in graph.items():
        degree_differences[source] = degree_differences.get(source, 0) + len(targets)
        for target in targets:
            degree_differences[target] = degree_differences.get(target, 0) - 1

    start_node = [node for node, diff in degree_differences.items() if diff == -1][0]
    end_node = [node for node, diff in degree_differences.items() if diff == 1][0]
    
    if start_node in graph:
        graph[start_node].append(end_node)
    else:
        graph[start_node] = [end_node]

    cycle = find_eulerian_cycle(graph)
    for idx, node in enumerate(cycle):
        if node == start_node and cycle[(idx + 1) % len(cycle)] == end_node:
            return cycle[idx + 1:] + cycle[1:idx + 1]

    return cycle  # This should never happen if the input is valid

def construct_de_bruijn_graph_paired_reads(paired_reads: List[Tuple[str, str]]) -> Dict[Tuple[str, str], List[Tuple[str, str]]]:
    graph = defaultdict(list)
    for pair in paired_reads:
        graph[(pair[0][:-1], pair[1][:-1])].append((pair[0][1:], pair[1][1:]))
    return graph

def string_spelled_by_gapped_patterns(gapped_patterns: List[Tuple[str, str]], k: int, d: int) -> str:
    prefix_string = ''.join(pattern[0][0] for pattern in gapped_patterns[:-1]) + gapped_patterns[-1][0]
    suffix_string = ''.join(pattern[1][0] for pattern in gapped_patterns[:-1]) + gapped_patterns[-1][1]
    
    for i in range(k + d + 1, len(prefix_string)):
        if prefix_string[i] != suffix_string[i - k - d - 1]:
            return "-1"
    return prefix_string + suffix_string[len(suffix_string) - k - d - 1:]

def reconstruct_string_from_read_pairs(k: int, d: int, paired_reads: List[Tuple[str, str]]) -> str:
    graph = construct_de_bruijn_graph_paired_reads(paired_reads)
    path = find_eulerian_path(graph)
    return string_spelled_by_gapped_patterns(path, k - 1, d)

sample_input: str = """
4 2
GAGA|TTGA
TCGT|GATG
CGTG|ATGT
TGGT|TGAG
GTGA|TGTT
GTGG|GTGA
TGAG|GTTG
GGTC|GAGA
GTCG|AGAT
"""

input_lines: List[str] = sample_input.strip().split("\n")
k, d = map(int, input_lines[0].split())
paired_reads: List[Tuple[str, str]] = [tuple(line.split("|")) for line in input_lines[1:]]

print(reconstruct_string_from_read_pairs(k, d, paired_reads))

32 Generate Contigs from a Collection of Reads

Contig Generation Problem. Generate the contigs from a collection of reads (with imperfect coverage).

Given: A collection of k-mers Patterns.

Return: All contigs in DeBruijn(Patterns). (You may return the strings in any order.)

32.1 Sample Dataset

ATG
ATG
TGT
TGG
CAT
GGA
GAT
AGA

32.2 Sample Output

AGA ATG ATG CAT GAT TGGA TGT

32.3 Solution

from typing import List, Dict, Tuple
from collections import defaultdict

def construct_de_bruijn_graph(kmers: List[str]) -> Dict[str, List[str]]:
    adjacency_dict: Dict[str, List[str]] = defaultdict(list)
    for kmer in kmers:
        prefix, suffix = kmer[:-1], kmer[1:]
        adjacency_dict[prefix].append(suffix)
    return adjacency_dict

def remove_edge(graph: Dict[str, List[str]], source: str, target: str) -> Dict[str, List[str]]:
    graph[source].remove(target)
    if not graph[source]:
        del graph[source]
    return graph

def find_maximal_non_branching_paths(graph: Dict[str, List[str]]) -> List[List[str]]:
    paths: List[List[str]] = []
    in_out_degrees: Dict[str, List[int]] = {}

    # Calculate in and out degrees
    for source, targets in graph.items():
        if source not in in_out_degrees:
            in_out_degrees[source] = [0, len(targets)]
        else:
            in_out_degrees[source][1] += len(targets)

        for target in targets:
            if target not in in_out_degrees:
                in_out_degrees[target] = [1, 0]
            else:
                in_out_degrees[target][0] += 1

    # Find all non-branching paths
    for node in list(in_out_degrees):
        if in_out_degrees[node] != [1, 1]:
            if in_out_degrees[node][1] > 0:
                while node in graph:
                    next_node = graph[node][0]
                    non_branching_path = [node, next_node]
                    graph = remove_edge(graph, node, next_node)
                    while in_out_degrees[next_node] == [1, 1]:
                        following_node = graph[next_node][0]
                        non_branching_path.append(following_node)
                        graph = remove_edge(graph, next_node, following_node)
                        next_node = following_node
                    paths.append(non_branching_path)

    # Find isolated cycles
    while graph:
        start_node = next(iter(graph))
        current_node = graph[start_node][0]
        graph = remove_edge(graph, start_node, current_node)
        cycle = [start_node, current_node]
        while current_node != start_node:
            next_node = graph[current_node][0]
            cycle.append(next_node)
            graph = remove_edge(graph, current_node, next_node)
            current_node = next_node
        paths.append(cycle)

    return paths

def generate_contigs(kmers: List[str]) -> List[str]:
    graph = construct_de_bruijn_graph(kmers)
    paths = find_maximal_non_branching_paths(graph)
    contigs: List[str] = []
    for path in paths:
        contig = path[0]
        for node in path[1:]:
            contig += node[-1]
        contigs.append(contig)
    return contigs

sample_input: str = """
ATG
ATG
TGT
TGG
CAT
GGA
GAT
AGA
"""

kmers: List[str] = sample_input.strip().split("\n")
contigs = generate_contigs(kmers)
contigs.sort()
print(" ".join(contigs))

33 Construct a String Spelled by a Gapped Genome Path

Gapped Genome Path String Problem. Reconstruct a string from a sequence of (k,d)-mers corresponding to a path in a paired de Bruijn graph.

Given: A sequence of (k, d)-mers (a1|b1),…, (an|bn) such that Suffix(ai|bi) = Prefix(ai+1|bi+1) for all i from 1 to n-1.

Return: A string Text where the i-th k-mer in Text is equal to Suffix(ai|bi) for all i from 1 to n, if such a string exists.

33.1 Sample Dataset

4 2
GACC|GCGC
ACCG|CGCC
CCGA|GCCG
CGAG|CCGG
GAGC|CGGA

33.2 Sample Output

GACCGAGCGCCGGA

33.3 Solution

from typing import List, Tuple

def reconstruct_string_from_gapped_patterns(gapped_patterns: List[Tuple[str, str]], k: int, d: int) -> str:
    prefix_string = ''
    suffix_string = ''
    for i, (prefix, suffix) in enumerate(gapped_patterns):
        if i != len(gapped_patterns) - 1:
            prefix_string += prefix[0]
            suffix_string += suffix[0]
        else:
            prefix_string += prefix
            suffix_string += suffix
    
    for i in range(k + d + 1, len(prefix_string)):
        if prefix_string[i] != suffix_string[i - k - d - 1]:
            return "-1"
    
    return prefix_string + suffix_string[len(suffix_string) - k - d - 1:]

sample_input: str = """
4 2
GACC|GCGC
ACCG|CGCC
CCGA|GCCG
CGAG|CCGG
GAGC|CGGA
"""

input_lines: List[str] = sample_input.strip().split("\n")
k, d = map(int, input_lines[0].split())
gapped_patterns: List[Tuple[str, str]] = [tuple(line.split("|")) for line in input_lines[1:]]

print(reconstruct_string_from_gapped_patterns(gapped_patterns, k - 1, d))

34 Generate All Maximal Non-Branching Paths in a Graph

Maximal Non-Branching Path Problem. Find all maximal non-branching paths in a graph.

Given: The adjacency list of a graph whose nodes are integers.

Return: The collection of all maximal non-branching paths in the graph.

34.1 Sample Dataset

1 -> 2
2 -> 3
3 -> 4,5
6 -> 7
7 -> 6

34.2 Sample Output

1 -> 2 -> 3
3 -> 4
3 -> 5
6 -> 7 -> 6

34.3 Solution

from typing import List, Dict, Tuple
from re import split

def parse_adjacency_list(adjacency_text: List[str]) -> Dict[str, List[str]]:
    adjacency_dict: Dict[str, List[str]] = {}
    for line in adjacency_text:
        source, targets = split(' -> ', line)
        adjacency_dict[source] = targets.split(',')
    return adjacency_dict

def remove_edge(graph: Dict[str, List[str]], source: str, target: str) -> Dict[str, List[str]]:
    graph[source].remove(target)
    if not graph[source]:
        del graph[source]
    return graph

def find_maximal_non_branching_paths(graph: Dict[str, List[str]]) -> List[List[str]]:
    paths: List[List[str]] = []
    in_out_degrees: Dict[str, List[int]] = {}

    # Calculate in and out degrees
    for node, neighbors in graph.items():
        if node not in in_out_degrees:
            in_out_degrees[node] = [0, len(neighbors)]
        else:
            in_out_degrees[node][1] += len(neighbors)

        for neighbor in neighbors:
            if neighbor not in in_out_degrees:
                in_out_degrees[neighbor] = [1, 0]
            else:
                in_out_degrees[neighbor][0] += 1

    # Find all non-branching paths
    for node in list(in_out_degrees):
        if in_out_degrees[node] != [1, 1]:
            if in_out_degrees[node][1] > 0:
                while node in graph:
                    next_node = graph[node][0]
                    non_branching_path = [node, next_node]
                    graph = remove_edge(graph, node, next_node)
                    while in_out_degrees[next_node] == [1, 1]:
                        following_node = graph[next_node][0]
                        non_branching_path.append(following_node)
                        graph = remove_edge(graph, next_node, following_node)
                        next_node = following_node
                    paths.append(non_branching_path)

    # Find isolated cycles
    while graph:
        start_node = next(iter(graph))
        current_node = graph[start_node][0]
        graph = remove_edge(graph, start_node, current_node)
        cycle = [start_node, current_node]
        while current_node != start_node:
            next_node = graph[current_node][0]
            cycle.append(next_node)
            graph = remove_edge(graph, current_node, next_node)
            current_node = next_node
        paths.append(cycle)

    return paths

sample_input: str = """
1 -> 2
2 -> 3
3 -> 4,5
6 -> 7
7 -> 6
"""

input_lines: List[str] = sample_input.strip().split("\n")
adjacency_list = parse_adjacency_list(input_lines)

result = find_maximal_non_branching_paths(adjacency_list)
for path in result:
    print(" -> ".join(path))

35 Translate an RNA String into an Amino Acid String

Protein Translation Problem. Translate an RNA string into an amino acid string.

Given: An RNA string Pattern.

Return: The translation of Pattern into an amino acid string Peptide.

35.1 Sample Dataset

AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA

35.2 Sample Output

MAMAPRTEINSTRING

35.3 Solution

from typing import Dict, List

def translate_rna_to_protein(rna_sequence: str) -> str:
    # RNA 코돈을 아미노산으로 변환하는 딕셔너리
    codon_table: Dict[str, str] = {
        'UUU': 'F', 'UUC': 'F', 'UUA': 'L', 'UUG': 'L',
        'UCU': 'S', 'UCC': 'S', 'UCA': 'S', 'UCG': 'S',
        'UAU': 'Y', 'UAC': 'Y', 'UAA': '*', 'UAG': '*',
        'UGU': 'C', 'UGC': 'C', 'UGA': '*', 'UGG': 'W',
        'CUU': 'L', 'CUC': 'L', 'CUA': 'L', 'CUG': 'L',
        'CCU': 'P', 'CCC': 'P', 'CCA': 'P', 'CCG': 'P',
        'CAU': 'H', 'CAC': 'H', 'CAA': 'Q', 'CAG': 'Q',
        'CGU': 'R', 'CGC': 'R', 'CGA': 'R', 'CGG': 'R',
        'AUU': 'I', 'AUC': 'I', 'AUA': 'I', 'AUG': 'M',
        'ACU': 'T', 'ACC': 'T', 'ACA': 'T', 'ACG': 'T',
        'AAU': 'N', 'AAC': 'N', 'AAA': 'K', 'AAG': 'K',
        'AGU': 'S', 'AGC': 'S', 'AGA': 'R', 'AGG': 'R',
        'GUU': 'V', 'GUC': 'V', 'GUA': 'V', 'GUG': 'V',
        'GCU': 'A', 'GCC': 'A', 'GCA': 'A', 'GCG': 'A',
        'GAU': 'D', 'GAC': 'D', 'GAA': 'E', 'GAG': 'E',
        'GGU': 'G', 'GGC': 'G', 'GGA': 'G', 'GGG': 'G'
    }
    
    protein_sequence: str = ""
    
    # RNA 서열을 3개의 뉴클레오티드(코돈)씩 나누어 처리
    for i in range(0, len(rna_sequence), 3):
        codon: str = rna_sequence[i:i+3]
        
        # 코돈이 3개의 뉴클레오티드로 완전하지 않으면 중단
        if len(codon) != 3:
            break
        
        # 코돈을 아미노산으로 변환
        amino_acid: str = codon_table.get(codon, '')
        
        # 종결 코돈('*')을 만나면 번역 중단
        if amino_acid == '*':
            break
        
        protein_sequence += amino_acid
    
    return protein_sequence

# 입력 RNA 서열
sample_input: str = """
AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA
"""

rna_sequence: str = ''.join(sample_input.strip().split())

# RNA를 단백질로 번역
protein: str = translate_rna_to_protein(rna_sequence)

print(protein)

36 Find Substrings of a Genome Encoding a Given Amino Acid String

Peptide Encoding Problem, Find substrings of a genome encoding a given amino acid sequence.

Given: A DNA string Text and an amino acid string Peptide.

Return: All substrings of Text encoding Peptide (if any such substrings exist).

36.1 Sample Dataset

ATGGCCATGGCCCCCAGAACTGAGATCAATAGTACCCGTATTAACGGGTGA
MA

36.2 Sample Output

ATGGCC
GGCCAT
ATGGCC

36.3 Solution

from typing import Dict, List

def translate_rna_to_protein(rna_sequence: str) -> str:
    codon_to_amino_acid: Dict[str, str] = {
        'UUU': 'F', 'UUC': 'F', 'UUA': 'L', 'UUG': 'L',
        'UCU': 'S', 'UCC': 'S', 'UCA': 'S', 'UCG': 'S',
        'UAU': 'Y', 'UAC': 'Y', 'UAA': '*', 'UAG': '*',
        'UGU': 'C', 'UGC': 'C', 'UGA': '*', 'UGG': 'W',
        'CUU': 'L', 'CUC': 'L', 'CUA': 'L', 'CUG': 'L',
        'CCU': 'P', 'CCC': 'P', 'CCA': 'P', 'CCG': 'P',
        'CAU': 'H', 'CAC': 'H', 'CAA': 'Q', 'CAG': 'Q',
        'CGU': 'R', 'CGC': 'R', 'CGA': 'R', 'CGG': 'R',
        'AUU': 'I', 'AUC': 'I', 'AUA': 'I', 'AUG': 'M',
        'ACU': 'T', 'ACC': 'T', 'ACA': 'T', 'ACG': 'T',
        'AAU': 'N', 'AAC': 'N', 'AAA': 'K', 'AAG': 'K',
        'AGU': 'S', 'AGC': 'S', 'AGA': 'R', 'AGG': 'R',
        'GUU': 'V', 'GUC': 'V', 'GUA': 'V', 'GUG': 'V',
        'GCU': 'A', 'GCC': 'A', 'GCA': 'A', 'GCG': 'A',
        'GAU': 'D', 'GAC': 'D', 'GAA': 'E', 'GAG': 'E',
        'GGU': 'G', 'GGC': 'G', 'GGA': 'G', 'GGG': 'G'
    }
    
    protein_sequence: List[str] = []
    
    for i in range(0, len(rna_sequence), 3):
        codon: str = rna_sequence[i:i+3]
        
        if len(codon) != 3:
            break
        
        amino_acid: str = codon_to_amino_acid.get(codon, '')
        
        if amino_acid == '*':
            break
        
        protein_sequence.append(amino_acid)
    
    return ''.join(protein_sequence)

def reverse_complement(dna_sequence: str) -> str:
    return dna_sequence[::-1].translate(str.maketrans("ACGT", "TGCA"))

def dna_to_rna(dna_sequence: str) -> str:
    return dna_sequence.replace("T", "U")

def find_peptide_encoding_substrings(dna_sequence: str, peptide: str) -> List[str]:
    substring_length: int = len(peptide) * 3
    encoding_substrings: List[str] = []

    for i in range(len(dna_sequence) - substring_length + 1):
        dna_substring: str = dna_sequence[i:i + substring_length]
        reverse_complement_substring: str = reverse_complement(dna_substring)

        rna_substring: str = dna_to_rna(dna_substring)
        reverse_complement_rna: str = dna_to_rna(reverse_complement_substring)

        if (translate_rna_to_protein(rna_substring) == peptide or 
            translate_rna_to_protein(reverse_complement_rna) == peptide):
            encoding_substrings.append(dna_substring)

    return encoding_substrings

sample_input: str = """
ATGGCCATGGCCCCCAGAACTGAGATCAATAGTACCCGTATTAACGGGTGA
MA
"""

dna_sequence, peptide = sample_input.strip().split('\n')
result: List[str] = find_peptide_encoding_substrings(dna_sequence, peptide)
print("\n".join(result))

37 Generate the Theoretical Spectrum of a Cyclic Peptide

Generating Theoretical Spectrum Problem, Generate the theoretical spectrum of a cyclic peptide.

Given: An amino acid string Peptide.

Return: Cyclospectrum(Peptide).

37.1 Sample Dataset

LEQN

37.2 Sample Output

0 113 114 128 129 227 242 242 257 355 356 370 371 484

37.3 Solution

from typing import Dict, List

AMINO_ACID_MASSES: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163
}

def calculate_cyclospectrum(peptide: str) -> List[int]:
    total_mass: int = sum(AMINO_ACID_MASSES[amino_acid] for amino_acid in peptide)
    spectrum: List[int] = [0, total_mass]
    circular_peptide: str = peptide + peptide
    
    for subpeptide_length in range(1, len(peptide)):
        for start_index in range(len(peptide)):
            subpeptide: str = circular_peptide[start_index:start_index + subpeptide_length]
            subpeptide_mass: int = sum(AMINO_ACID_MASSES[amino_acid] for amino_acid in subpeptide)
            spectrum.append(subpeptide_mass)
    
    return sorted(spectrum)

sample_input: str = """
LEQN
"""

input_peptide: str = sample_input.strip()

result: List[int] = calculate_cyclospectrum(input_peptide)
print(" ".join(map(str, result)))

38 Compute the Number of Peptides of Given Total Mass

Counting Peptides with Given Mass Problem, Compute the number of peptides of given total mass.

Given: An integer m.

Return: The number of linear peptides having integer mass m.

38.1 Sample Dataset

1024

38.2 Sample Output

14712706211

38.3 Solution

from collections import defaultdict
from typing import List, Dict

AMINO_ACID_MASSES: List[int] = [57, 71, 87, 97, 99, 101, 103, 113, 114, 115, 128, 129, 131, 137, 147, 156, 163, 186]
LIGHTEST_AMINO_ACID: int = min(AMINO_ACID_MASSES)

def count_possible_peptides(target_mass: int) -> int:
    peptide_count: Dict[int, int] = defaultdict(int)
    
    for current_mass in range(LIGHTEST_AMINO_ACID, target_mass + 1):
        peptide_count[current_mass] = sum(1 for amino_acid_mass in AMINO_ACID_MASSES if amino_acid_mass == current_mass)
        
        for amino_acid_mass in AMINO_ACID_MASSES:
            if current_mass >= amino_acid_mass:
                peptide_count[current_mass] += peptide_count[current_mass - amino_acid_mass]

    return peptide_count[target_mass]

sample_input: str = """
1024
"""
target_peptide_mass: int = int(sample_input.strip())
result: int = count_possible_peptides(target_peptide_mass)
print(result)

39 Find a Cyclic Peptide with Theoretical Spectrum Matching an Ideal Spectrum

Cyclopeptide Sequencing Problem, Given an ideal experimental spectrum, find a cyclic peptide whose theoretical spectrum matches the experimental spectrum.

Given: A collection of (possibly repeated) integers Spectrum corresponding to an ideal experimental spectrum.

Return: Every amino acid string Peptide such that Cyclospectrum(Peptide) = Spectrum (if such a string exists).

39.1 Sample Dataset

0 113 128 186 241 299 314 427

39.2 Sample Output

113-128-186 113-186-128 186-128-113 128-186-113 186-113-128 128-113-186

39.3 Solution

from typing import List, Set

AMINO_ACID_MASSES: List[int] = [57, 71, 87, 97, 99, 101, 103, 113, 114, 115, 128, 129, 131, 137, 147, 156, 163, 186]

def calculate_cyclospectrum(peptide: List[int]) -> List[int]:
    spectrum: List[int] = [0, sum(peptide)]
    extended_peptide: List[int] = peptide + peptide
    for k in range(1, len(peptide)):
        for i in range(len(peptide)):
            subpeptide: List[int] = extended_peptide[i:i + k]
            spectrum.append(sum(subpeptide))
    spectrum.sort()
    return spectrum

def calculate_linear_spectrum(peptide: List[int]) -> List[int]:
    prefix_mass: List[int] = [0]
    for mass in peptide:
        prefix_mass.append(prefix_mass[-1] + mass)
    linear_spectrum: List[int] = [0]
    for i in range(len(peptide)):
        for j in range(i + 1, len(peptide) + 1):
            linear_spectrum.append(prefix_mass[j] - prefix_mass[i])
    linear_spectrum.sort()
    return linear_spectrum

def expand_peptides(peptides: List[List[int]]) -> List[List[int]]:
    expanded_peptides: List[List[int]] = []
    for peptide in peptides:
        for mass in AMINO_ACID_MASSES:
            expanded_peptides.append(peptide + [mass])
    return expanded_peptides

def is_consistent(peptide: List[int], spectrum: List[int]) -> bool:
    if sum(peptide) > spectrum[-1] - AMINO_ACID_MASSES[0]:
        return False
    peptide_spectrum: List[int] = calculate_linear_spectrum(peptide)
    return all(mass in spectrum for mass in peptide_spectrum)

def cyclopeptide_sequencing(spectrum: List[int]) -> Set[str]:
    candidate_peptides: List[List[int]] = [[]]
    result: Set[str] = set()
    
    while candidate_peptides:
        candidate_peptides = expand_peptides(candidate_peptides)
        for peptide in candidate_peptides[:]:
            if sum(peptide) == spectrum[-1]:
                if calculate_cyclospectrum(peptide) == spectrum:
                    result.add("-".join(map(str, peptide)))
                candidate_peptides.remove(peptide)
            elif not is_consistent(peptide, spectrum):
                candidate_peptides.remove(peptide)
    
    return result

sample_input: str = """
0 113 128 186 241 299 314 427
"""

input_spectrum: List[int] = [int(x) for x in sample_input.strip().split()]

result: Set[str] = cyclopeptide_sequencing(input_spectrum)
print(" ".join(result))

40 Compute the Score of a Cyclic Peptide Against a Spectrum

Cyclic Peptide Scoring Problem, Compute the score of a cyclic peptide against a spectrum.

Given: An amino acid string Peptide and a collection of integers Spectrum.

Return: The score of Peptide against SpectrumScore(PeptideSpectrum).

40.1 Sample Dataset

NQEL
0 99 113 114 128 227 257 299 355 356 370 371 484

40.2 Sample Output

11

40.3 Solution

from typing import Dict, List

AMINO_ACID_MASSES: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163
}

def calculate_cyclospectrum(peptide: str) -> List[int]:
    total_mass: int = sum(AMINO_ACID_MASSES[aa] for aa in peptide)
    spectrum: List[int] = [0, total_mass]
    extended_peptide: str = peptide + peptide
    
    for length in range(1, len(peptide)):
        for start in range(len(peptide)):
            subpeptide: str = extended_peptide[start:start + length]
            subpeptide_mass: int = sum(AMINO_ACID_MASSES[aa] for aa in subpeptide)
            spectrum.append(subpeptide_mass)
    
    spectrum.sort()
    return spectrum

def calculate_score(peptide: str, experimental_spectrum: List[int]) -> int:
    theoretical_spectrum: List[int] = calculate_cyclospectrum(peptide)
    score: int = 0
    unique_masses: set = set(theoretical_spectrum + experimental_spectrum)
    
    for mass in unique_masses:
        score += min(theoretical_spectrum.count(mass), experimental_spectrum.count(mass))
    
    return score

sample_input: str = """
NQEL
0 99 113 114 128 227 257 299 355 356 370 371 484
"""

input_lines: List[str] = sample_input.strip().split("\n")
input_peptide: str = input_lines[0]
input_spectrum: List[int] = [int(x) for x in input_lines[1].split()]

result: int = calculate_score(input_peptide, input_spectrum)
print(result)

41 Implement LeaderboardCyclopeptideSequencing

Implement LeaderboardCyclopeptideSequencing

Given: An integer N and a collection of integers Spectrum.

Return: LeaderPeptide after running LeaderboardCyclopeptideSequencing(SpectrumN).

41.1 Sample Dataset

10
0 71 113 129 147 200 218 260 313 331 347 389 460

41.2 Sample Output

113-147-71-129

41.3 Solution

from typing import List, Set, Dict

AMINO_ACID_MASSES: List[int] = [57, 71, 87, 97, 99, 101, 103, 113, 114, 115, 128, 129, 131, 137, 147, 156, 163, 186]

def expand_peptides(peptides: List[List[int]]) -> List[List[int]]:
    expanded_peptides: List[List[int]] = []
    for peptide in peptides:
        for mass in AMINO_ACID_MASSES:
            expanded_peptides.append(peptide + [mass])
    return expanded_peptides

def calculate_cyclospectrum(peptide: List[int]) -> List[int]:
    total_mass: int = sum(peptide)
    spectrum: List[int] = [0, total_mass]
    extended_peptide: List[int] = peptide + peptide
    
    for length in range(1, len(peptide)):
        for start in range(len(peptide)):
            subpeptide: List[int] = extended_peptide[start:start + length]
            subpeptide_mass: int = sum(subpeptide)
            spectrum.append(subpeptide_mass)
    
    spectrum.sort()
    return spectrum

def is_consistent(peptide: List[int], spectrum: List[int]) -> bool:
    peptide_spectrum: List[int] = calculate_cyclospectrum(peptide)
    return all(peptide_spectrum.count(mass) <= spectrum.count(mass) for mass in set(peptide_spectrum))

def cyclopeptide_sequencing(spectrum: List[int]) -> Set[str]:
    result: Set[str] = set()
    candidate_peptides: List[List[int]] = [[]]
    while candidate_peptides:
        candidate_peptides = expand_peptides(candidate_peptides)
        for peptide in candidate_peptides[:]:
            if sum(peptide) == spectrum[-1]:
                if calculate_cyclospectrum(peptide) == spectrum:
                    result.add("-".join(map(str, peptide)))
                candidate_peptides.remove(peptide)
            elif not is_consistent(peptide, spectrum):
                candidate_peptides.remove(peptide)
    return result

def calculate_score(peptide: List[int], spectrum: List[int]) -> int:
    peptide_spectrum: List[int] = calculate_cyclospectrum(peptide)
    score: int = 0
    unique_masses: Set[int] = set(peptide_spectrum + spectrum)
    for mass in unique_masses:
        score += min(peptide_spectrum.count(mass), spectrum.count(mass))
    return score

def trim_leaderboard(leaderboard: List[List[int]], spectrum: List[int], n: int) -> List[List[int]]:
    if len(leaderboard) <= n:
        return leaderboard

    scores: Dict[int, int] = {}
    for i, peptide in enumerate(leaderboard):
        scores[i] = calculate_score(peptide, spectrum)

    sorted_scores: List[int] = sorted(scores.values(), reverse=True)
    threshold: int = sorted_scores[n - 1] if n <= len(sorted_scores) else sorted_scores[-1]

    return [leaderboard[idx] for idx, score in scores.items() if score >= threshold]

def leaderboard_cyclopeptide_sequencing(spectrum: List[int], n: int) -> List[int]:
    leaderboard: List[List[int]] = [[]]
    leader_peptide: List[int] = []

    while leaderboard:
        leaderboard = expand_peptides(leaderboard)
        for peptide in leaderboard[:]:
            if sum(peptide) == spectrum[-1]:
                if calculate_score(peptide, spectrum) > calculate_score(leader_peptide, spectrum):
                    leader_peptide = peptide
            elif sum(peptide) > spectrum[-1]:
                leaderboard.remove(peptide)
        leaderboard = trim_leaderboard(leaderboard, spectrum, n)
    return leader_peptide

sample_input: str = """
10
0 71 113 129 147 200 218 260 313 331 347 389 460
"""

input_lines: List[str] = sample_input.strip().split("\n")
n: int = int(input_lines[0])
spectrum: List[int] = [int(x) for x in input_lines[1].split()]

result: List[int] = leaderboard_cyclopeptide_sequencing(spectrum, n)
print("-".join(map(str, result)))

42 Generate the Convolution of a Spectrum

Spectral Convolution Problem, Compute the convolution of a spectrum.

Given: A collection of integers Spectrum.

Return: The list of elements in the convolution of Spectrum in decreasing order of their multiplicities. If an element has multiplicity k, it should appear exactly k times.

42.1 Sample Dataset

0 137 186 323

42.2 Sample Output

137 137 186 186 323 49

42.3 Solution

from typing import List, Dict

def calculate_spectrum_convolution(spectrum: List[int]) -> List[int]:
    spectrum.sort()
    convolution_list: List[int] = []
    
    for i in range(len(spectrum) - 1):
        for j in range(i + 1, len(spectrum)):
            mass_difference: int = spectrum[j] - spectrum[i]
            if mass_difference != 0:
                convolution_list.append(mass_difference)

    frequency_dict: Dict[int, int] = {}
    for mass in set(convolution_list):
        frequency_dict[mass] = convolution_list.count(mass)

    sorted_masses: List[int] = sorted(frequency_dict, key=frequency_dict.get, reverse=True)
    
    result: List[int] = []
    for mass in sorted_masses:
        result.extend([mass] * frequency_dict[mass])
    
    return result

sample_input: str = """
0 137 186 323
"""

input_spectrum: List[int] = [int(x) for x in sample_input.strip().split()]

convolution_result: List[int] = calculate_spectrum_convolution(input_spectrum)
print(" ".join(map(str, convolution_result)))

43 Implement ConvolutionCyclopeptideSequencing

Implement ConvolutionCyclopeptideSequencing.

Given: An integer M, an integer N, and a collection of (possibly repeated) integers Spectrum.

Return: A cyclic peptide LeaderPeptide with amino acids taken only from the top M elements (and ties) of the convolution of Spectrum that fall between 57 and 200, and where the size of Leaderboard is restricted to the top N (and ties).

43.1 Sample Dataset

20
60
57 57 71 99 129 137 170 186 194 208 228 265 285 299 307 323 356 364 394 422 493

43.2 Sample Output

99-71-137-57-72-57

43.3 Solution

from typing import List, Dict, Tuple

def calculate_spectrum_convolution(spectrum: List[int]) -> List[int]:
    spectrum.sort()
    convolution_list: List[int] = []
    for i in range(len(spectrum) - 1):
        for j in range(i, len(spectrum)):
            if spectrum[j] - spectrum[i] != 0:
                convolution_list.append(spectrum[j] - spectrum[i])

    frequency_dict: Dict[int, int] = {}
    for mass in set(convolution_list):
        frequency_dict[mass] = convolution_list.count(mass)

    sorted_masses: List[int] = [k for k, _ in sorted(frequency_dict.items(), key=lambda item: item[1], reverse=True)]
    result: List[int] = []
    for mass in sorted_masses:
        result += [mass] * frequency_dict[mass]
    return result

def trim_leaderboard(leaderboard: List[List[int]], spectrum: List[int], n: int) -> List[List[int]]:
    if len(leaderboard) <= n:
        return leaderboard

    scores: Dict[int, int] = {}
    for i, peptide in enumerate(leaderboard):
        scores[i] = calculate_score(peptide, spectrum)

    sorted_scores: List[int] = sorted(scores.values(), reverse=True)
    threshold: int = sorted_scores[n - 1]

    return [leaderboard[idx] for idx, score in scores.items() if score >= threshold]

def calculate_cyclospectrum(peptide: List[int]) -> List[int]:
    spectrum: List[int] = [0, sum(peptide)]
    extended_peptide: List[int] = peptide + peptide
    for k in range(1, len(peptide)):
        for i in range(len(peptide)):
            subpeptide: List[int] = extended_peptide[i:i + k]
            spectrum.append(sum(subpeptide))
    spectrum.sort()
    return spectrum

def calculate_score(peptide: List[int], spectrum: List[int]) -> int:
    peptide_spectrum: List[int] = calculate_cyclospectrum(peptide)
    score: int = 0
    unique_masses: set = set(peptide_spectrum + spectrum)
    for mass in unique_masses:
        score += min(peptide_spectrum.count(mass), spectrum.count(mass))
    return score

def find_top_masses(spectrum: List[int], m: int) -> List[int]:
    convolution: List[int] = calculate_spectrum_convolution(spectrum)
    filtered_convolution: List[int] = [x for x in convolution if 57 <= x <= 200]

    frequency_dict: Dict[int, int] = {}
    for mass in set(filtered_convolution):
        frequency_dict[mass] = filtered_convolution.count(mass)

    sorted_elements: List[Tuple[int, int]] = sorted(frequency_dict.items(), key=lambda kv: kv[1], reverse=True)
    top_masses: List[int] = [mass for mass, freq in sorted_elements if freq >= sorted_elements[m - 1][1]]
    top_masses.sort()
    return top_masses

def expand_peptides(peptides: List[List[int]], masses: List[int]) -> List[List[int]]:
    expanded_peptides: List[List[int]] = []
    for peptide in peptides:
        for mass in masses:
            expanded_peptides.append(peptide + [mass])
    return expanded_peptides

def convolution_cyclopeptide_sequencing(spectrum: List[int], m: int, n: int) -> List[int]:
    masses: List[int] = find_top_masses(spectrum, m)
    leaderboard: List[List[int]] = [[]]
    leader_peptide: List[int] = []

    while leaderboard:
        leaderboard = expand_peptides(leaderboard, masses)
        for peptide in leaderboard[:]:
            if sum(peptide) == spectrum[-1]:
                if calculate_score(peptide, spectrum) > calculate_score(leader_peptide, spectrum):
                    leader_peptide = peptide
            elif sum(peptide) > spectrum[-1]:
                leaderboard.remove(peptide)
        leaderboard = trim_leaderboard(leaderboard, spectrum, n)
    return leader_peptide

sample_input: str = """
20
60
57 57 71 99 129 137 170 186 194 208 228 265 285 299 307 323 356 364 394 422 493
"""
input_lines: List[str] = sample_input.strip().split("\n")
m: int = int(input_lines[0])
n: int = int(input_lines[1])
spectrum: List[int] = [int(x) for x in input_lines[2].split()]

result: List[int] = convolution_cyclopeptide_sequencing(spectrum, m, n)
print("-".join(map(str, result)))

44 Generate the Theoretical Spectrum of a Linear Peptide

Linear Spectrum Problem, Generate the ideal linear spectrum of a peptide.

Given: An amino acid string Peptide.

Return: The linear spectrum of Peptide.

44.1 Sample Dataset

NQEL

44.2 Sample Output

0 113 114 128 129 242 242 257 370 371 484

44.3 Solution

from typing import List, Dict

AMINO_ACID_MASSES: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137,
    'K': 128, 'M': 131, 'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156,
    'T': 101, 'W': 186, 'V': 99, 'Y': 163
}

def calculate_linear_spectrum(peptide: str) -> List[int]:
    prefix_masses: List[int] = [0]
    
    for amino_acid in peptide:
        current_mass = prefix_masses[-1] + AMINO_ACID_MASSES[amino_acid]
        prefix_masses.append(current_mass)
    
    linear_spectrum: List[int] = [0]
    
    for i in range(len(peptide)):
        for j in range(i + 1, len(peptide) + 1):
            subpeptide_mass = prefix_masses[j] - prefix_masses[i]
            linear_spectrum.append(subpeptide_mass)
    
    return sorted(linear_spectrum)

# Sample input
sample_peptide: str = "NQEL"

# Calculate and print the linear spectrum
result: List[int] = calculate_linear_spectrum(sample_peptide)
print(" ".join(map(str, result)))

45 Compute the Score of a Linear Peptide

Linear Peptide Scoring Problem, Compute the score of a linear peptide with respect to a spectrum.

Given: An amino acid string Peptide and a collection of integers LinearSpectrum.

Return: The linear score of Peptide against SpectrumLinearScore(PeptideSpectrum).

45.1 Sample Dataset

NQEL
0 99 113 114 128 227 257 299 355 356 370 371 484

45.2 Sample Output

8

45.3 Solution

from typing import List, Dict

AMINO_ACID_MASSES: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137,
    'K': 128, 'M': 131, 'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156,
    'T': 101, 'W': 186, 'V': 99, 'Y': 163
}

def calculate_linear_spectrum(peptide: str) -> List[int]:
    prefix_masses: List[int] = [0]
    
    for amino_acid in peptide:
        current_mass = prefix_masses[-1] + AMINO_ACID_MASSES[amino_acid]
        prefix_masses.append(current_mass)
    
    linear_spectrum: List[int] = [0]
    
    for i in range(len(peptide)):
        for j in range(i + 1, len(peptide) + 1):
            subpeptide_mass = prefix_masses[j] - prefix_masses[i]
            linear_spectrum.append(subpeptide_mass)
    
    return sorted(linear_spectrum)

def calculate_linear_score(peptide: str, experimental_spectrum: List[int]) -> int:
    theoretical_spectrum: List[int] = calculate_linear_spectrum(peptide)
    score: int = 0
    unique_masses: set = set(theoretical_spectrum + experimental_spectrum)
    
    for mass in unique_masses:
        score += min(theoretical_spectrum.count(mass), experimental_spectrum.count(mass))
    
    return score

# Sample input
sample_input: str = """
NQEL
0 99 113 114 128 227 257 299 355 356 370 371 484
"""

input_lines: List[str] = sample_input.strip().split("\n")
input_peptide: str = input_lines[0]
input_spectrum: List[int] = [int(x) for x in input_lines[1].split()]

# Calculate and print the linear score
result: int = calculate_linear_score(input_peptide, input_spectrum)
print(result)

46 Trim a Peptide Leaderboard

Trim Problem, Trim a leaderboard of peptides.

Given: A leaderboard of linear peptides Leaderboard, a linear spectrum Spectrum, and an integer N.

Return: The top N peptides from Leaderboard scored against Spectrum. Remember to use LinearScore.

46.1 Sample Dataset

LAST ALST TLLT TQAS
0 71 87 101 113 158 184 188 259 271 372
2

46.2 Sample Output

LAST ALST

46.3 Solution

from typing import List, Dict

AMINO_ACID_MASSES: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137,
    'K': 128, 'M': 131, 'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156,
    'T': 101, 'W': 186, 'V': 99, 'Y': 163
}

def calculate_linear_spectrum(peptide: str) -> List[int]:
    prefix_masses: List[int] = [0]
    
    for amino_acid in peptide:
        current_mass = prefix_masses[-1] + AMINO_ACID_MASSES[amino_acid]
        prefix_masses.append(current_mass)
    
    linear_spectrum: List[int] = [0]
    
    for i in range(len(peptide)):
        for j in range(i + 1, len(peptide) + 1):
            subpeptide_mass = prefix_masses[j] - prefix_masses[i]
            linear_spectrum.append(subpeptide_mass)
    
    return sorted(linear_spectrum)

def calculate_linear_score(peptide: str, experimental_spectrum: List[int]) -> int:
    theoretical_spectrum: List[int] = calculate_linear_spectrum(peptide)
    score: int = 0
    unique_masses: set = set(theoretical_spectrum + experimental_spectrum)
    
    for mass in unique_masses:
        score += min(theoretical_spectrum.count(mass), experimental_spectrum.count(mass))
    
    return score

def trim_leaderboard(leaderboard: List[str], spectrum: List[int], n: int) -> List[str]:
    if len(leaderboard) <= n:
        return leaderboard

    peptide_scores: Dict[int, int] = {}
    for i, peptide in enumerate(leaderboard):
        peptide_scores[i] = calculate_linear_score(peptide, spectrum)

    sorted_scores: List[int] = sorted(peptide_scores.values(), reverse=True)
    score_threshold: int = sorted_scores[n - 1]

    return [leaderboard[idx] for idx, score in peptide_scores.items() if score >= score_threshold]

# Sample input
sample_input: str = """
LAST ALST TLLT TQAS
0 71 87 101 113 158 184 188 259 271 372
2
"""

input_lines: List[str] = sample_input.strip().split("\n")
input_leaderboard: List[str] = input_lines[0].split()
input_spectrum: List[int] = [int(x) for x in input_lines[1].split()]
input_n: int = int(input_lines[2])

result: List[str] = trim_leaderboard(input_leaderboard, input_spectrum, input_n)
print(" ".join(result))

47 Solve the Turnpike Problem

Turnpike Problem. Given all pairwise distances between points on a line segment, reconstruct the positions of those points.

Given: A collection of integers L.

Return: A set A such that \(∆A\) = L.

47.1 Sample Dataset

-10 -8 -7 -6 -5 -4 -3 -3 -2 -2 0 0 0 0 0 2 2 3 3 4 5 6 7 8 10

47.2 Sample Output

0 2 4 7 10

47.3 Solution

from typing import List, Set, Optional

def calculate_absolute_differences(set_a: Set[int], set_b: Set[int]) -> List[int]:
    return [abs(a - b) for a in set_a for b in set_b]

def is_multiset_subset(subset: List[int], superset: List[int]) -> bool:
    return all(subset.count(elem) <= superset.count(elem) for elem in set(subset))

def multiset_difference(set_a: List[int], set_b: List[int]) -> List[int]:
    difference: List[int] = []
    unique_elements: Set[int] = set(set_a)
    for elem in unique_elements:
        count_difference = set_a.count(elem) - set_b.count(elem)
        if count_difference > 0:
            difference.extend([elem] * count_difference)
    return sorted(difference)

def place_elements(distances: List[int]) -> Optional[Set[int]]:
    if not distances:
        return placed_elements

    current_distance: int = distances[-1]
    
    # Try placing on the left
    left_differences: List[int] = calculate_absolute_differences({current_distance}, placed_elements)
    if is_multiset_subset(left_differences, distances):
        placed_elements.add(current_distance)
        remaining_distances_left: List[int] = multiset_difference(distances, left_differences)
        left_result: Optional[Set[int]] = place_elements(remaining_distances_left)
        if left_result:
            return left_result
        placed_elements.remove(current_distance)

    # Try placing on the right
    right_differences: List[int] = calculate_absolute_differences({total_width - current_distance}, placed_elements)
    if is_multiset_subset(right_differences, distances):
        placed_elements.add(total_width - current_distance)
        remaining_distances_right: List[int] = multiset_difference(distances, right_differences)
        right_result: Optional[Set[int]] = place_elements(remaining_distances_right)
        if right_result:
            return right_result
        placed_elements.remove(total_width - current_distance)

    return None

# Sample input
sample_input: str = """
-10 -8 -7 -6 -5 -4 -3 -3 -2 -2 0 0 0 0 0 2 2 3 3 4 5 6 7 8 10
"""

input_distances: List[int] = [int(x) for x in sample_input.strip().split()]
positive_distances: List[int] = [x for x in input_distances if x > 0]

total_width: int = positive_distances.pop(-1)
placed_elements: Set[int] = {0, total_width}

result: Optional[Set[int]] = place_elements(positive_distances)
print(" ".join(map(str, sorted(result))))

48 Find the Minimum Number of Coins Needed to Make Change

The Change Problem, Find the minimum number of coins needed to make change

Given: An integer money and an array Coins of positive integers.

Return: The minimum number of coins with denominations Coins that changes money.

48.1 Sample Dataset

40
1,5,10,20,25,50

48.2 Sample Output

2

48.3 Solution

from typing import List

def min_coins_for_change(target_amount: int, available_coins: List[int]) -> int:
    min_coins_needed = [0]
    for current_amount in range(1, target_amount + 1):
        min_coins_needed.append(target_amount + 1)
        for coin in available_coins:
            if current_amount >= coin:
                coins_for_current = min_coins_needed[current_amount - coin] + 1
                if coins_for_current < min_coins_needed[current_amount]:
                    min_coins_needed[current_amount] = coins_for_current
    return min_coins_needed[target_amount]

sample_input = """
40
1,5,10,20,25,50
"""

input_lines = sample_input.strip().split("\n")
target_amount = int(input_lines[0])
available_coins = [int(x) for x in input_lines[1].split(",")]

print(min_coins_for_change(target_amount, available_coins))

49 Find the Length of a Longest Path in a Manhattan-like Grid

Length of a Longest Path in the Manhattan Tourist Problem. Find the length of a longest path in a rectangular city.

Given: Integers n and m, followed by an n × (m+1) matrix Down and an (n+1) × m matrix Right. The two matrices are separated by the”-“symbol.

Return: The length of a longest path from source (0, 0) to sink (nm) in the n × m rectangular grid whose edges are defined by the matrices Down and Right.

49.1 Sample Dataset

4 4
1 0 2 4 3
4 6 5 2 1
4 4 5 2 1
5 6 8 5 3
-
3 2 4 0
3 2 4 2
0 7 3 3
3 3 0 2
1 3 2 2

49.2 Sample Output

34

49.3 Solution

from typing import List, Tuple

def parse_manhattan_tourist_input(input_text: str) -> Tuple[int, int, List[List[int]], List[List[int]]]:
    lines = input_text.strip().split('\n')
    rows, cols = map(int, lines[0].split())
    
    down_weights = [[0] * (cols + 1) for _ in range(rows)]
    for i in range(rows):
        line = list(map(int, lines[i + 1].split()))
        for j in range(cols + 1):
            down_weights[i][j] = line[j]

    separator_index = rows + 1
    right_weights = [[0] * cols for _ in range(rows + 1)]
    for i in range(rows + 1):
        line = list(map(int, lines[i + separator_index + 1].split()))
        for j in range(cols):
            right_weights[i][j] = line[j]

    return rows, cols, down_weights, right_weights

def calculate_longest_manhattan_path(rows: int, cols: int, down_weights: List[List[int]], right_weights: List[List[int]]) -> int:
    path_scores = [[0] * (cols + 1) for _ in range(rows + 1)]
    
    for i in range(1, rows + 1):
        path_scores[i][0] = path_scores[i - 1][0] + down_weights[i - 1][0]

    for j in range(1, cols + 1):
        path_scores[0][j] = path_scores[0][j - 1] + right_weights[0][j - 1]

    for i in range(1, rows + 1):
        for j in range(1, cols + 1):
            path_scores[i][j] = max(path_scores[i - 1][j] + down_weights[i - 1][j],
                                    path_scores[i][j - 1] + right_weights[i][j - 1])
    
    return path_scores[rows][cols]

sample_input = """
4 4
1 0 2 4 3
4 6 5 2 1
4 4 5 2 1
5 6 8 5 3
-
3 2 4 0
3 2 4 2
0 7 3 3
3 3 0 2
1 3 2 2
"""

rows, cols, down_weights, right_weights = parse_manhattan_tourist_input(sample_input)
longest_path_score = calculate_longest_manhattan_path(rows, cols, down_weights, right_weights)
print(f"{longest_path_score}")

50 Find a Longest Common Subsequence of Two Strings

Longest Common Subsequence Problem.

Given: Two strings.

Return: A longest common subsequence of these strings.

50.1 Sample Dataset

AACCTTGG
ACACTGTGA

50.2 Sample Output

AACTGG

50.3 Solution

from typing import List, Tuple

def longest_common_subsequence(sequence1: str, sequence2: str) -> str:
    padded_seq1 = '-' + sequence1
    padded_seq2 = '-' + sequence2

    score_matrix: List[List[int]] = [[0 for _ in range(len(padded_seq2))] for _ in range(len(padded_seq1))]
    backtrack_matrix: List[List[str]] = [['' for _ in range(len(padded_seq2))] for _ in range(len(padded_seq1))]

    for i in range(1, len(padded_seq1)):
        for j in range(1, len(padded_seq2)):
            match_score = score_matrix[i - 1][j - 1] + (1 if padded_seq1[i] == padded_seq2[j] else 0)
            score_matrix[i][j] = max(score_matrix[i - 1][j], score_matrix[i][j - 1], match_score)

            if score_matrix[i][j] == score_matrix[i - 1][j]:
                backtrack_matrix[i][j] = "up"
            elif score_matrix[i][j] == score_matrix[i][j - 1]:
                backtrack_matrix[i][j] = "left"
            else:
                backtrack_matrix[i][j] = "diag"

    lcs = ""
    i, j = len(padded_seq1) - 1, len(padded_seq2) - 1
    while i > 0 and j > 0:
        if backtrack_matrix[i][j] == "diag":
            lcs = padded_seq1[i] + lcs
            i -= 1
            j -= 1
        elif backtrack_matrix[i][j] == "left":
            j -= 1
        else:
            i -= 1

    return lcs

sample_input = """
AACCTTGG
ACACTGTGA
"""

input_lines = sample_input.strip().split("\n")
sequence1 = input_lines[0]
sequence2 = input_lines[1]

print(longest_common_subsequence(sequence1, sequence2))

51 Find the Longest Path in a DAG

Longest Path in a DAG Problem. Find a longest path between two nodes in an edge-weighted DAG.

Given: An integer representing the source node of a graph, followed by an integer representing the sink node of the graph, followed by an edge-weighted graph. The graph is represented by a modified adjacency list in which the notation”0->1:7”indicates that an edge connects node 0 to node 1 with weight 7.

Return: The length of a longest path in the graph, followed by a longest path. (If multiple longest paths exist, you may return any one.)

51.1 Sample Dataset

0
4
0->1:7
0->2:4
2->3:2
1->4:1
3->4:3

51.2 Sample Output

9
0->2->3->4

51.3 Solution

from typing import List, Tuple, Dict, Optional

class Node:
    def __init__(self, label: str):
        self.label: str = label
        self.parent_nodes: List[Tuple['Node', int]] = []
        self.target_nodes: List[Tuple['Node', int]] = []
        self.visited: bool = False

class DAG:
    def __init__(self):
        self.nodes_dict: Dict[str, Node] = {}
        self.distances: Dict[str, float] = {}
        self.backtrack: Dict[str, Optional[str]] = {}

    def add_node(self, label: str) -> Node:
        if label in self.nodes_dict:
            return self.nodes_dict[label]

        new_node = Node(label)
        self.nodes_dict[label] = new_node
        return new_node

    def construct_dag(self, adjacency_list: List[str]) -> None:
        for line in adjacency_list:
            source_label, temp = line.split("->")
            target_label, weight_str = temp.split(":")
            weight = int(weight_str)

            source_node = self.add_node(source_label)
            target_node = self.add_node(target_label)

            source_node.target_nodes.append((target_node, weight))
            target_node.parent_nodes.append((source_node, weight))

    def topological_sort_util(self, current_node: Node, sorted_labels: List[str]) -> None:
        current_node.visited = True
        for neighbor, _ in current_node.target_nodes:
            if not neighbor.visited:
                self.topological_sort_util(neighbor, sorted_labels)
        sorted_labels.insert(0, current_node.label)

    def topological_sort(self) -> List[str]:
        sorted_labels: List[str] = []
        for node in self.nodes_dict.values():
            if not node.visited:
                self.topological_sort_util(node, sorted_labels)
        return sorted_labels

    def longest_path(self, source: str, sink: str) -> Tuple[float, List[str]]:
        for label in self.nodes_dict:
            self.distances[label] = float("-inf")

        self.distances[source] = 0
        self.backtrack[source] = None

        topological_order = self.topological_sort()
        for label in topological_order:
            current_node = self.nodes_dict[label]
            for target_node, weight in current_node.target_nodes:
                if self.distances[target_node.label] < self.distances[label] + weight:
                    self.distances[target_node.label] = self.distances[label] + weight
                    self.backtrack[target_node.label] = label

        path: List[str] = [sink]
        current_label = self.backtrack[sink]
        while current_label != source:
            path = [current_label] + path
            current_label = self.backtrack[current_label]
        path = [source] + path
        return self.distances[sink], path

# Sample input
sample_input: str = """
0
4
0->1:7
0->2:4
2->3:2
1->4:1
3->4:3
"""

input_lines = sample_input.strip().split("\n")
source_label: str = input_lines[0]
sink_label: str = input_lines[1]
adjacency_list: List[str] = input_lines[2:]

graph = DAG()
graph.construct_dag(adjacency_list)
longest_distance, longest_path = graph.longest_path(source_label, sink_label)
print(longest_distance)
print("->".join(longest_path))

52 Find a Highest-Scoring Alignment of Two Strings

Global Alignment Problem. Find the highest-scoring alignment between two strings using a scoring matrix.

Given: Two amino acid strings.

Return: The maximum alignment score of these strings followed by an alignment achieving this maximum score. Use the BLOSUM62 scoring matrix and indel penalty σ = 5. (If multiple alignments achieving the maximum score exist, you may return any one.)

52.1 Sample Dataset

PLEASANTLY
MEANLY

52.2 Sample Output

8
PLEASANTLY
-MEA--N-LY

52.3 Solution

from typing import Dict, Tuple, List

BLOSUM62: Dict[Tuple[str, str], int] = {
    ('W', 'F'): 1, ('L', 'R'): -2, ('S', 'P'): -1, ('V', 'T'): 0,
    ('Q', 'Q'): 5, ('N', 'A'): -2, ('Z', 'Y'): -2, ('W', 'R'): -3,
    ('Q', 'A'): -1, ('S', 'D'): 0, ('H', 'H'): 8, ('S', 'H'): -1,
    ('H', 'D'): -1, ('L', 'N'): -3, ('W', 'A'): -3, ('Y', 'M'): -1,
    ('G', 'R'): -2, ('Y', 'I'): -1, ('Y', 'E'): -2, ('B', 'Y'): -3,
    ('Y', 'A'): -2, ('V', 'D'): -3, ('B', 'S'): 0, ('Y', 'Y'): 7,
    ('G', 'N'): 0, ('E', 'C'): -4, ('Y', 'Q'): -1, ('Z', 'Z'): 4,
    ('V', 'A'): 0, ('C', 'C'): 9, ('M', 'R'): -1, ('V', 'E'): -2,
    ('T', 'N'): 0, ('P', 'P'): 7, ('V', 'I'): 3, ('V', 'S'): -2,
    ('Z', 'P'): -1, ('V', 'M'): 1, ('T', 'F'): -2, ('V', 'Q'): -2,
    ('K', 'K'): 5, ('P', 'D'): -1, ('I', 'H'): -3, ('I', 'D'): -3,
    ('T', 'R'): -1, ('P', 'L'): -3, ('K', 'G'): -2, ('M', 'N'): -2,
    ('P', 'H'): -2, ('F', 'Q'): -3, ('Z', 'G'): -2, ('X', 'L'): -1,
    ('T', 'M'): -1, ('Z', 'C'): -3, ('X', 'H'): -1, ('D', 'R'): -2,
    ('B', 'W'): -4, ('X', 'D'): -1, ('Z', 'K'): 1, ('F', 'A'): -2,
    ('Z', 'W'): -3, ('F', 'E'): -3, ('D', 'N'): 1, ('B', 'K'): 0,
    ('X', 'X'): -1, ('F', 'I'): 0, ('B', 'G'): -1, ('X', 'T'): 0,
    ('F', 'M'): 0, ('B', 'C'): -3, ('Z', 'I'): -3, ('Z', 'V'): -2,
    ('S', 'S'): 4, ('L', 'Q'): -2, ('W', 'E'): -3, ('Q', 'R'): 1,
    ('N', 'N'): 6, ('W', 'M'): -1, ('Q', 'C'): -3, ('W', 'I'): -3,
    ('S', 'C'): -1, ('L', 'A'): -1, ('S', 'G'): 0, ('L', 'E'): -3,
    ('W', 'Q'): -2, ('H', 'G'): -2, ('S', 'K'): 0, ('Q', 'N'): 0,
    ('N', 'R'): 0, ('H', 'C'): -3, ('Y', 'N'): -2, ('G', 'Q'): -2,
    ('Y', 'F'): 3, ('C', 'A'): 0, ('V', 'L'): 1, ('G', 'E'): -2,
    ('G', 'A'): 0, ('K', 'R'): 2, ('E', 'D'): 2, ('Y', 'R'): -2,
    ('M', 'Q'): 0, ('T', 'I'): -1, ('C', 'D'): -3, ('V', 'F'): -1,
    ('T', 'A'): 0, ('T', 'P'): -1, ('B', 'P'): -2, ('T', 'E'): -1,
    ('V', 'N'): -3, ('P', 'G'): -2, ('M', 'A'): -1, ('K', 'H'): -1,
    ('V', 'R'): -3, ('P', 'C'): -3, ('M', 'E'): -2, ('K', 'L'): -2,
    ('V', 'V'): 4, ('M', 'I'): 1, ('T', 'Q'): -1, ('I', 'G'): -4,
    ('P', 'K'): -1, ('M', 'M'): 5, ('K', 'D'): -1, ('I', 'C'): -1,
    ('Z', 'D'): 1, ('F', 'R'): -3, ('X', 'K'): -1, ('Q', 'D'): 0,
    ('X', 'G'): -1, ('Z', 'L'): -3, ('X', 'C'): -2, ('Z', 'H'): 0,
    ('B', 'L'): -4, ('B', 'H'): 0, ('F', 'F'): 6, ('X', 'W'): -2,
    ('B', 'D'): 4, ('D', 'A'): -2, ('S', 'L'): -2, ('X', 'S'): 0,
    ('F', 'N'): -3, ('S', 'R'): -1, ('W', 'D'): -4, ('V', 'Y'): -1,
    ('W', 'L'): -2, ('H', 'R'): 0, ('W', 'H'): -2, ('H', 'N'): 1,
    ('W', 'T'): -2, ('T', 'T'): 5, ('S', 'F'): -2, ('W', 'P'): -4,
    ('L', 'D'): -4, ('B', 'I'): -3, ('L', 'H'): -3, ('S', 'N'): 1,
    ('B', 'T'): -1, ('L', 'L'): 4, ('Y', 'K'): -2, ('E', 'Q'): 2,
    ('Y', 'G'): -3, ('Z', 'S'): 0, ('Y', 'C'): -2, ('G', 'D'): -1,
    ('B', 'V'): -3, ('E', 'A'): -1, ('Y', 'W'): 2, ('E', 'E'): 5,
    ('Y', 'S'): -2, ('C', 'N'): -3, ('V', 'C'): -1, ('T', 'H'): -2,
    ('P', 'R'): -2, ('V', 'G'): -3, ('T', 'L'): -1, ('V', 'K'): -2,
    ('K', 'Q'): 1, ('R', 'A'): -1, ('I', 'R'): -3, ('T', 'D'): -1,
    ('P', 'F'): -4, ('I', 'N'): -3, ('K', 'I'): -3, ('M', 'D'): -3,
    ('V', 'W'): -3, ('W', 'W'): 11, ('M', 'H'): -2, ('P', 'N'): -2,
    ('K', 'A'): -1, ('M', 'L'): 2, ('K', 'E'): 1, ('Z', 'E'): 4,
    ('X', 'N'): -1, ('Z', 'A'): -1, ('Z', 'M'): -1, ('X', 'F'): -1,
    ('K', 'C'): -3, ('B', 'Q'): 0, ('X', 'B'): -1, ('B', 'M'): -3,
    ('F', 'C'): -2, ('Z', 'Q'): 3, ('X', 'Z'): -1, ('F', 'G'): -3,
    ('B', 'E'): 1, ('X', 'V'): -1, ('F', 'K'): -3, ('B', 'A'): -2,
    ('X', 'R'): -1, ('D', 'D'): 6, ('W', 'G'): -2, ('Z', 'F'): -3,
    ('S', 'Q'): 0, ('W', 'C'): -2, ('W', 'K'): -3, ('H', 'Q'): 0,
    ('L', 'C'): -1, ('W', 'N'): -4, ('S', 'A'): 1, ('L', 'G'): -4,
    ('W', 'S'): -3, ('S', 'E'): 0, ('H', 'E'): 0, ('S', 'I'): -2,
    ('H', 'A'): -2, ('S', 'M'): -1, ('Y', 'L'): -1, ('Y', 'H'): 2,
    ('Y', 'D'): -3, ('E', 'R'): 0, ('X', 'P'): -2, ('G', 'G'): 6,
    ('G', 'C'): -3, ('E', 'N'): 0, ('Y', 'T'): -2, ('Y', 'P'): -3,
    ('T', 'K'): -1, ('A', 'A'): 4, ('P', 'Q'): -1, ('T', 'C'): -1,
    ('V', 'H'): -3, ('T', 'G'): -2, ('I', 'Q'): -3, ('Z', 'T'): -1,
    ('C', 'R'): -3, ('V', 'P'): -2, ('P', 'E'): -1, ('M', 'C'): -1,
    ('K', 'N'): 0, ('I', 'I'): 4, ('P', 'A'): -1, ('M', 'G'): -3,
    ('T', 'S'): 1, ('I', 'E'): -3, ('P', 'M'): -2, ('M', 'K'): -1,
    ('I', 'A'): -1, ('P', 'I'): -3, ('R', 'R'): 5, ('X', 'M'): -1,
    ('L', 'I'): 2, ('X', 'I'): -1, ('Z', 'B'): 1, ('X', 'E'): -1,
    ('Z', 'N'): 0, ('X', 'A'): 0, ('B', 'R'): -1, ('B', 'N'): 3,
    ('F', 'D'): -3, ('X', 'Y'): -1, ('Z', 'R'): 0, ('F', 'H'): -1,
    ('B', 'F'): -3, ('F', 'L'): 0, ('X', 'Q'): -1, ('B', 'B'): 4
}

def global_alignment(sequence1: str, sequence2: str, indel_penalty: int = 5) -> Tuple[int, str, str]:
    padded_seq1: str = "-" + sequence1
    padded_seq2: str = "-" + sequence2

    score_matrix: List[List[int]] = [[0 for _ in range(len(padded_seq2))] for _ in range(len(padded_seq1))]
    backtrack_matrix: List[List[str]] = [['' for _ in range(len(padded_seq2))] for _ in range(len(padded_seq1))]

    for j in range(len(padded_seq2)):
        score_matrix[0][j] = -indel_penalty * j
        backtrack_matrix[0][j] = "left"

    for i in range(len(padded_seq1)):
        score_matrix[i][0] = -indel_penalty * i
        backtrack_matrix[i][0] = "up"

    for i in range(1, len(padded_seq1)):
        for j in range(1, len(padded_seq2)):
            key: Tuple[str, str] = (padded_seq1[i], padded_seq2[j]) if (padded_seq1[i], padded_seq2[j]) in BLOSUM62 else (padded_seq2[j], padded_seq1[i])
            diagonal_score: int = score_matrix[i - 1][j - 1] + BLOSUM62[key]
            up_score: int = score_matrix[i - 1][j] - indel_penalty
            left_score: int = score_matrix[i][j - 1] - indel_penalty
            score_matrix[i][j] = max(diagonal_score, up_score, left_score)
            
            if score_matrix[i][j] == diagonal_score:
                backtrack_matrix[i][j] = "diagonal"
            elif score_matrix[i][j] == up_score:
                backtrack_matrix[i][j] = "up"
            else:
                backtrack_matrix[i][j] = "left"

    i: int = len(padded_seq1) - 1
    j: int = len(padded_seq2) - 1
    aligned_seq1: str = ""
    aligned_seq2: str = ""
    
    while i != 0 or j != 0:
        direction: str = backtrack_matrix[i][j]
        if direction == "diagonal":
            aligned_seq1 = padded_seq1[i] + aligned_seq1
            aligned_seq2 = padded_seq2[j] + aligned_seq2
            i -= 1
            j -= 1
        elif direction == "up":
            aligned_seq1 = padded_seq1[i] + aligned_seq1
            aligned_seq2 = "-" + aligned_seq2
            i -= 1
        else:
            aligned_seq1 = "-" + aligned_seq1
            aligned_seq2 = padded_seq2[j] + aligned_seq2
            j -= 1

    return score_matrix[len(padded_seq1) - 1][len(padded_seq2) - 1], aligned_seq1, aligned_seq2

# Sample input
sample_input: str = """
PLEASANTLY
MEANLY
"""

input_lines: List[str] = sample_input.strip().split("\n")
sequence1: str = input_lines[0]
sequence2: str = input_lines[1]
alignment_score: int
aligned_sequence1: str
aligned_sequence2: str
alignment_score, aligned_sequence1, aligned_sequence2 = global_alignment(sequence1, sequence2)
print(alignment_score)
print(aligned_sequence1)
print(aligned_sequence2)

53 Find a Highest-Scoring Local Alignment of Two Strings

Local Alignment Problem, Find the highest-scoring local alignment between two strings.

Given: Two amino acid strings.

Return: The maximum score of a local alignment of the strings, followed by a local alignment of these strings achieving the maximum score. Use the PAM250 scoring matrix and indel penalty σ = 5. (If multiple local alignments achieving the maximum score exist, you may return any one.)

53.1 Sample Dataset

MEANLY
PENALTY

53.2 Sample Output

15
EANL-Y
ENALTY

53.3 Solution

from typing import Dict, List, Tuple, Optional

PAM250: Dict[str, Dict[str, int]] = {
        'A': {'A': 2, 'C': -2, 'D': 0, 'E': 0, 'F': -3, 'G': 1, 'H': -1, 'I': -1, 'K': -1, 'L': -2, 'M': -1, 'N': 0,
                'P': 1, 'Q': 0, 'R': -2, 'S': 1, 'T': 1, 'V': 0, 'W': -6, 'Y': -3},
          'C': {'A': -2, 'C': 12, 'D': -5, 'E': -5, 'F': -4, 'G': -3, 'H': -3, 'I': -2, 'K': -5, 'L': -6, 'M': -5,
                'N': -4, 'P': -3, 'Q': -5, 'R': -4, 'S': 0, 'T': -2, 'V': -2, 'W': -8, 'Y': 0},
          'D': {'A': 0, 'C': -5, 'D': 4, 'E': 3, 'F': -6, 'G': 1, 'H': 1, 'I': -2, 'K': 0, 'L': -4, 'M': -3, 'N': 2,
                'P': -1, 'Q': 2, 'R': -1, 'S': 0, 'T': 0, 'V': -2, 'W': -7, 'Y': -4},
          'E': {'A': 0, 'C': -5, 'D': 3, 'E': 4, 'F': -5, 'G': 0, 'H': 1, 'I': -2, 'K': 0, 'L': -3, 'M': -2, 'N': 1,
                'P': -1, 'Q': 2, 'R': -1, 'S': 0, 'T': 0, 'V': -2, 'W': -7, 'Y': -4},
          'F': {'A': -3, 'C': -4, 'D': -6, 'E': -5, 'F': 9, 'G': -5, 'H': -2, 'I': 1, 'K': -5, 'L': 2, 'M': 0, 'N': -3,
                'P': -5, 'Q': -5, 'R': -4, 'S': -3, 'T': -3, 'V': -1, 'W': 0, 'Y': 7},
          'G': {'A': 1, 'C': -3, 'D': 1, 'E': 0, 'F': -5, 'G': 5, 'H': -2, 'I': -3, 'K': -2, 'L': -4, 'M': -3, 'N': 0,
                'P': 0, 'Q': -1, 'R': -3, 'S': 1, 'T': 0, 'V': -1, 'W': -7, 'Y': -5},
          'H': {'A': -1, 'C': -3, 'D': 1, 'E': 1, 'F': -2, 'G': -2, 'H': 6, 'I': -2, 'K': 0, 'L': -2, 'M': -2, 'N': 2,
                'P': 0, 'Q': 3, 'R': 2, 'S': -1, 'T': -1, 'V': -2, 'W': -3, 'Y': 0},
          'I': {'A': -1, 'C': -2, 'D': -2, 'E': -2, 'F': 1, 'G': -3, 'H': -2, 'I': 5, 'K': -2, 'L': 2, 'M': 2, 'N': -2,
                'P': -2, 'Q': -2, 'R': -2, 'S': -1, 'T': 0, 'V': 4, 'W': -5, 'Y': -1},
          'K': {'A': -1, 'C': -5, 'D': 0, 'E': 0, 'F': -5, 'G': -2, 'H': 0, 'I': -2, 'K': 5, 'L': -3, 'M': 0, 'N': 1,
                'P': -1, 'Q': 1, 'R': 3, 'S': 0, 'T': 0, 'V': -2, 'W': -3, 'Y': -4},
          'L': {'A': -2, 'C': -6, 'D': -4, 'E': -3, 'F': 2, 'G': -4, 'H': -2, 'I': 2, 'K': -3, 'L': 6, 'M': 4, 'N': -3,
                'P': -3, 'Q': -2, 'R': -3, 'S': -3, 'T': -2, 'V': 2, 'W': -2, 'Y': -1},
          'M': {'A': -1, 'C': -5, 'D': -3, 'E': -2, 'F': 0, 'G': -3, 'H': -2, 'I': 2, 'K': 0, 'L': 4, 'M': 6, 'N': -2,
                'P': -2, 'Q': -1, 'R': 0, 'S': -2, 'T': -1, 'V': 2, 'W': -4, 'Y': -2},
          'N': {'A': 0, 'C': -4, 'D': 2, 'E': 1, 'F': -3, 'G': 0, 'H': 2, 'I': -2, 'K': 1, 'L': -3, 'M': -2, 'N': 2,
                'P': 0, 'Q': 1, 'R': 0, 'S': 1, 'T': 0, 'V': -2, 'W': -4, 'Y': -2},
          'P': {'A': 1, 'C': -3, 'D': -1, 'E': -1, 'F': -5, 'G': 0, 'H': 0, 'I': -2, 'K': -1, 'L': -3, 'M': -2, 'N': 0,
                'P': 6, 'Q': 0, 'R': 0, 'S': 1, 'T': 0, 'V': -1, 'W': -6, 'Y': -5},
          'Q': {'A': 0, 'C': -5, 'D': 2, 'E': 2, 'F': -5, 'G': -1, 'H': 3, 'I': -2, 'K': 1, 'L': -2, 'M': -1, 'N': 1,
                'P': 0, 'Q': 4, 'R': 1, 'S': -1, 'T': -1, 'V': -2, 'W': -5, 'Y': -4},
          'R': {'A': -2, 'C': -4, 'D': -1, 'E': -1, 'F': -4, 'G': -3, 'H': 2, 'I': -2, 'K': 3, 'L': -3, 'M': 0, 'N': 0,
                'P': 0, 'Q': 1, 'R': 6, 'S': 0, 'T': -1, 'V': -2, 'W': 2, 'Y': -4},
          'S': {'A': 1, 'C': 0, 'D': 0, 'E': 0, 'F': -3, 'G': 1, 'H': -1, 'I': -1, 'K': 0, 'L': -3, 'M': -2, 'N': 1,
                'P': 1, 'Q': -1, 'R': 0, 'S': 2, 'T': 1, 'V': -1, 'W': -2, 'Y': -3},
          'T': {'A': 1, 'C': -2, 'D': 0, 'E': 0, 'F': -3, 'G': 0, 'H': -1, 'I': 0, 'K': 0, 'L': -2, 'M': -1, 'N': 0,
                'P': 0, 'Q': -1, 'R': -1, 'S': 1, 'T': 3, 'V': 0, 'W': -5, 'Y': -3},
          'V': {'A': 0, 'C': -2, 'D': -2, 'E': -2, 'F': -1, 'G': -1, 'H': -2, 'I': 4, 'K': -2, 'L': 2, 'M': 2, 'N': -2,
                'P': -1, 'Q': -2, 'R': -2, 'S': -1, 'T': 0, 'V': 4, 'W': -6, 'Y': -2},
          'W': {'A': -6, 'C': -8, 'D': -7, 'E': -7, 'F': 0, 'G': -7, 'H': -3, 'I': -5, 'K': -3, 'L': -2, 'M': -4,
                'N': -4, 'P': -6, 'Q': -5, 'R': 2, 'S': -2, 'T': -5, 'V': -6, 'W': 17, 'Y': 0},
          'Y': {'A': -3, 'C': 0, 'D': -4, 'E': -4, 'F': 7, 'G': -5, 'H': 0, 'I': -1, 'K': -4, 'L': -1, 'M': -2, 'N': -2,
                'P': -5, 'Q': -4, 'R': -4, 'S': -3, 'T': -3, 'V': -2, 'W': 0, 'Y': 10}}

def local_alignment(sequence1: str, sequence2: str, indel_penalty: int = 5) -> Tuple[int, str, str]:
    padded_seq1: str = "-" + sequence1
    padded_seq2: str = "-" + sequence2

    score_matrix: List[List[int]] = [[0 for _ in range(len(padded_seq2))] for _ in range(len(padded_seq1))]
    backtrack_matrix: List[List[Optional[str]]] = [[None for _ in range(len(padded_seq2))] for _ in range(len(padded_seq1))]

    for i in range(1, len(padded_seq1)):
        for j in range(1, len(padded_seq2)):
            key1: str = padded_seq1[i] if padded_seq1[i] in PAM250 else padded_seq2[j]
            key2: str = padded_seq2[j] if padded_seq1[i] in PAM250 else padded_seq1[i]

            diagonal_score: int = score_matrix[i - 1][j - 1] + PAM250[key1][key2]
            up_score: int = score_matrix[i - 1][j] - indel_penalty
            left_score: int = score_matrix[i][j - 1] - indel_penalty
            score_matrix[i][j] = max(diagonal_score, up_score, left_score, 0)

            if score_matrix[i][j] == diagonal_score:
                backtrack_matrix[i][j] = "diagonal"
            elif score_matrix[i][j] == up_score:
                backtrack_matrix[i][j] = "up"
            elif score_matrix[i][j] == left_score:
                backtrack_matrix[i][j] = "left"

    max_score: int = -1
    max_i: int = 0
    max_j: int = 0
    for i in range(len(padded_seq1)):
        for j in range(len(padded_seq2)):
            if score_matrix[i][j] > max_score:
                max_score = score_matrix[i][j]
                max_i, max_j = i, j

    i: int = max_i
    j: int = max_j
    aligned_seq1: str = ""
    aligned_seq2: str = ""
    while backtrack_matrix[i][j] is not None:
        direction: str = backtrack_matrix[i][j]
        if direction == "diagonal":
            aligned_seq1 = padded_seq1[i] + aligned_seq1
            aligned_seq2 = padded_seq2[j] + aligned_seq2
            i -= 1
            j -= 1
        elif direction == "up":
            aligned_seq1 = padded_seq1[i] + aligned_seq1
            aligned_seq2 = "-" + aligned_seq2
            i -= 1
        else:
            aligned_seq1 = "-" + aligned_seq1
            aligned_seq2 = padded_seq2[j] + aligned_seq2
            j -= 1

    return max_score, aligned_seq1, aligned_seq2

# Sample input
sample_input: str = """
MEANLY
PENALTY
"""

input_lines: List[str] = sample_input.strip().split("\n")
sequence1: str = input_lines[0]
sequence2: str = input_lines[1]

alignment_score: int
aligned_sequence1: str
aligned_sequence2: str
alignment_score, aligned_sequence1, aligned_sequence2 = local_alignment(sequence1, sequence2)
print(alignment_score)
print(aligned_sequence1)
print(aligned_sequence2)

54 Compute the Edit Distance Between Two Strings

Edit Distance Problem. Find the edit distance between two strings.

Given: Two amino acid strings.

Return: The edit distance between these strings.

54.1 Sample Dataset

PLEASANTLY
MEANLY

54.2 Sample Output

5

54.3 Solution

def calculate_edit_distance(source: str, target: str) -> int:
    distance_matrix = {}
    
    for target_index in range(len(target) + 1):
        distance_matrix[target_index, 0] = target_index
    
    for source_index in range(len(source) + 1):
        distance_matrix[0, source_index] = source_index

    for target_index in range(len(target)):
        for source_index in range(len(source)):
            if source[source_index] == target[target_index]:
                distance_matrix[target_index + 1, source_index + 1] = distance_matrix[target_index, source_index]
            else:
                distance_matrix[target_index + 1, source_index + 1] = min([
                    distance_matrix[target_index + 1, source_index],
                    distance_matrix[target_index, source_index],
                    distance_matrix[target_index, source_index + 1]
                ]) + 1

    return distance_matrix[len(target), len(source)]

sample_input: str = """
PLEASANTLY
MEANLY
"""

source, target = sample_input.strip().split("\n")
print(calculate_edit_distance(source, target))

55 Find a Highest-Scoring Fitting Alignment of Two Strings

Fitting Alignment Problem. Construct a highest-scoring fitting alignment between two strings.

Given: Two DNA strings v and w, where v has length at most 10000 and w has length at most 1000.

Return: The maximum score of a fitting alignment of v and w, followed by a fitting alignment achieving this maximum score. Use the simple scoring method in which matches count +1 and both the mismatch and indel penalties are equal to 1. (If multiple fitting alignments achieving the maximum score exist, you may return any one.)

55.1 Sample Dataset

GTAGGCTTAAGGTTA
TAGATA

55.2 Sample Output

2
TAGGCTTA
TAGA--TA

55.3 Solution

from typing import Tuple, Dict

def calculate_fitting_alignment(sequence1: str, sequence2: str) -> Tuple[int, str, str]:
    score_matrix: Dict[Tuple[int, int], int] = {}
    path_matrix: Dict[Tuple[int, int], str] = {}
    
    for seq2_index in range(len(sequence2) + 1):
        score_matrix[seq2_index, 0] = -seq2_index
        path_matrix[seq2_index, 0] = "↑"
    for seq1_index in range(len(sequence1) + 1):
        score_matrix[0, seq1_index] = 0
        path_matrix[0, seq1_index] = "←"

    score_matrix[0, 0] = 0
    for seq2_index in range(len(sequence2)):
        for seq1_index in range(len(sequence1)):
            current_position = (seq2_index + 1, seq1_index + 1)
            match_score = 1 if sequence1[seq1_index] == sequence2[seq2_index] else -1
            options = [
                score_matrix[seq2_index, seq1_index] + match_score,
                score_matrix[seq2_index, seq1_index + 1] - 1,
                score_matrix[seq2_index + 1, seq1_index] - 1,
            ]
            score_matrix[current_position] = max(options)
            path_matrix[current_position] = ["↖", "↑", "←"][options.index(max(options))]

    final_scores = [score_matrix[len(sequence2), i] for i in range(len(sequence1) + 1)]
    max_score = max(final_scores)
    seq1_end_index = final_scores.index(max_score)
    seq2_end_index = len(sequence2)

    aligned_seq1, aligned_seq2 = "", ""
    while seq1_end_index > 0 and seq2_end_index > 0:
        if path_matrix[seq2_end_index, seq1_end_index] == "↖":
            aligned_seq1 += sequence1[seq1_end_index - 1]
            aligned_seq2 += sequence2[seq2_end_index - 1]
            seq2_end_index, seq1_end_index = seq2_end_index - 1, seq1_end_index - 1
        elif path_matrix[seq2_end_index, seq1_end_index] == "←":
            aligned_seq1 += sequence1[seq1_end_index - 1]
            aligned_seq2 += "-"
            seq1_end_index = seq1_end_index - 1
        elif path_matrix[seq2_end_index, seq1_end_index] == "↑":
            aligned_seq1 += "-"
            aligned_seq2 += sequence2[seq2_end_index - 1]
            seq2_end_index = seq2_end_index - 1

    return max_score, aligned_seq1[::-1], aligned_seq2[::-1]

sample_input: str = """
GTAGGCTTAAGGTTA
TAGATA
"""

sequence1, sequence2 = sample_input.strip().split("\n")
print(*calculate_fitting_alignment(sequence1, sequence2), sep="\n")

56 Find a Highest-Scoring Overlap Alignment of Two Strings

Overlap Alignment Problem. Construct a highest-scoring overlap alignment between two strings.

Given: Two protein strings v and w, each of length at most 1000.

Return: The score of an optimal overlap alignment of v and w, followed by an alignment of a suffix v’ of v and a prefix w’ of w achieving this maximum score. Use an alignment score in which matches count +1 and both the mismatch and indel penalties are 2. (If multiple overlap alignments achieving the maximum score exist, you may return any one.)

56.1 Sample Dataset

PAWHEAE
HEAGAWGHEE

56.2 Sample Output

1
HEAE
HEAG

56.3 Solution

from typing import Tuple, Dict

def calculate_overlap_alignment(sequence1: str, sequence2: str, mismatch_penalty: int = -2) -> Tuple[int, str, str]:
    score_matrix: Dict[Tuple[int, int], int] = {}
    path_matrix: Dict[Tuple[int, int], str] = {}
    
    for seq2_index in range(len(sequence2) + 1):
        score_matrix[seq2_index, 0] = seq2_index * mismatch_penalty
        path_matrix[seq2_index, 0] = "↑"
    for seq1_index in range(len(sequence1) + 1):
        score_matrix[0, seq1_index] = 0
        path_matrix[0, seq1_index] = "←"

    score_matrix[0, 0] = 0
    for seq2_index in range(len(sequence2)):
        for seq1_index in range(len(sequence1)):
            current_position = (seq2_index + 1, seq1_index + 1)
            match_score = 1 if sequence1[seq1_index] == sequence2[seq2_index] else mismatch_penalty
            options = [
                score_matrix[seq2_index, seq1_index] + match_score,
                score_matrix[seq2_index, seq1_index + 1] + mismatch_penalty,
                score_matrix[seq2_index + 1, seq1_index] + mismatch_penalty,
            ]
            score_matrix[current_position] = max(options)
            path_matrix[current_position] = ["↖", "↑", "←"][options.index(max(options))]

    final_scores = [score_matrix[seq2_index, len(sequence1)] for seq2_index in range(len(sequence2) + 1)]
    max_score = max(final_scores)
    seq2_end_index = final_scores.index(max_score)
    seq1_end_index = len(sequence1)

    aligned_seq1, aligned_seq2 = "", ""
    while seq1_end_index > 0 and seq2_end_index > 0:
        if path_matrix[seq2_end_index, seq1_end_index] == "↖":
            aligned_seq1 += sequence1[seq1_end_index - 1]
            aligned_seq2 += sequence2[seq2_end_index - 1]
            seq2_end_index, seq1_end_index = seq2_end_index - 1, seq1_end_index - 1
        elif path_matrix[seq2_end_index, seq1_end_index] == "←":
            aligned_seq1 += sequence1[seq1_end_index - 1]
            aligned_seq2 += "-"
            seq1_end_index = seq1_end_index - 1
        elif path_matrix[seq2_end_index, seq1_end_index] == "↑":
            aligned_seq1 += "-"
            aligned_seq2 += sequence2[seq2_end_index - 1]
            seq2_end_index = seq2_end_index - 1

    return max_score, aligned_seq1[::-1], aligned_seq2[::-1]

sample_input: str = """
PAWHEAE
HEAGAWGHEE
"""

sequence1, sequence2 = sample_input.strip().split("\n")
print(*calculate_overlap_alignment(sequence1, sequence2), sep="\n")

57 Align Two Strings Using Affine Gap Penalties

Alignment with Affine Gap Penalties Problem. Construct a highest-scoring global alignment of two strings (with affine gap penalties).

Given: Two amino acid strings v and w (each of length at most 100).

Return: The maximum alignment score between v and w, followed by an alignment of v and w achieving this maximum score. Use the BLOSUM62 scoring matrix, a gap opening penalty of 11, and a gap extension penalty of 1.

57.1 Sample Dataset

PRTEINS
PRTWPSEIN

57.2 Sample Output

8
PRT---EINS
PRTWPSEIN-

57.3 Solution

from typing import Dict, Tuple, List, Optional

BLOSUM62: Dict[Tuple[str, str], int] = {
    ('W', 'F'): 1, ('L', 'R'): -2, ('S', 'P'): -1, ('V', 'T'): 0,
    ('Q', 'Q'): 5, ('N', 'A'): -2, ('Z', 'Y'): -2, ('W', 'R'): -3,
    ('Q', 'A'): -1, ('S', 'D'): 0, ('H', 'H'): 8, ('S', 'H'): -1,
    ('H', 'D'): -1, ('L', 'N'): -3, ('W', 'A'): -3, ('Y', 'M'): -1,
    ('G', 'R'): -2, ('Y', 'I'): -1, ('Y', 'E'): -2, ('B', 'Y'): -3,
    ('Y', 'A'): -2, ('V', 'D'): -3, ('B', 'S'): 0, ('Y', 'Y'): 7,
    ('G', 'N'): 0, ('E', 'C'): -4, ('Y', 'Q'): -1, ('Z', 'Z'): 4,
    ('V', 'A'): 0, ('C', 'C'): 9, ('M', 'R'): -1, ('V', 'E'): -2,
    ('T', 'N'): 0, ('P', 'P'): 7, ('V', 'I'): 3, ('V', 'S'): -2,
    ('Z', 'P'): -1, ('V', 'M'): 1, ('T', 'F'): -2, ('V', 'Q'): -2,
    ('K', 'K'): 5, ('P', 'D'): -1, ('I', 'H'): -3, ('I', 'D'): -3,
    ('T', 'R'): -1, ('P', 'L'): -3, ('K', 'G'): -2, ('M', 'N'): -2,
    ('P', 'H'): -2, ('F', 'Q'): -3, ('Z', 'G'): -2, ('X', 'L'): -1,
    ('T', 'M'): -1, ('Z', 'C'): -3, ('X', 'H'): -1, ('D', 'R'): -2,
    ('B', 'W'): -4, ('X', 'D'): -1, ('Z', 'K'): 1, ('F', 'A'): -2,
    ('Z', 'W'): -3, ('F', 'E'): -3, ('D', 'N'): 1, ('B', 'K'): 0,
    ('X', 'X'): -1, ('F', 'I'): 0, ('B', 'G'): -1, ('X', 'T'): 0,
    ('F', 'M'): 0, ('B', 'C'): -3, ('Z', 'I'): -3, ('Z', 'V'): -2,
    ('S', 'S'): 4, ('L', 'Q'): -2, ('W', 'E'): -3, ('Q', 'R'): 1,
    ('N', 'N'): 6, ('W', 'M'): -1, ('Q', 'C'): -3, ('W', 'I'): -3,
    ('S', 'C'): -1, ('L', 'A'): -1, ('S', 'G'): 0, ('L', 'E'): -3,
    ('W', 'Q'): -2, ('H', 'G'): -2, ('S', 'K'): 0, ('Q', 'N'): 0,
    ('N', 'R'): 0, ('H', 'C'): -3, ('Y', 'N'): -2, ('G', 'Q'): -2,
    ('Y', 'F'): 3, ('C', 'A'): 0, ('V', 'L'): 1, ('G', 'E'): -2,
    ('G', 'A'): 0, ('K', 'R'): 2, ('E', 'D'): 2, ('Y', 'R'): -2,
    ('M', 'Q'): 0, ('T', 'I'): -1, ('C', 'D'): -3, ('V', 'F'): -1,
    ('T', 'A'): 0, ('T', 'P'): -1, ('B', 'P'): -2, ('T', 'E'): -1,
    ('V', 'N'): -3, ('P', 'G'): -2, ('M', 'A'): -1, ('K', 'H'): -1,
    ('V', 'R'): -3, ('P', 'C'): -3, ('M', 'E'): -2, ('K', 'L'): -2,
    ('V', 'V'): 4, ('M', 'I'): 1, ('T', 'Q'): -1, ('I', 'G'): -4,
    ('P', 'K'): -1, ('M', 'M'): 5, ('K', 'D'): -1, ('I', 'C'): -1,
    ('Z', 'D'): 1, ('F', 'R'): -3, ('X', 'K'): -1, ('Q', 'D'): 0,
    ('X', 'G'): -1, ('Z', 'L'): -3, ('X', 'C'): -2, ('Z', 'H'): 0,
    ('B', 'L'): -4, ('B', 'H'): 0, ('F', 'F'): 6, ('X', 'W'): -2,
    ('B', 'D'): 4, ('D', 'A'): -2, ('S', 'L'): -2, ('X', 'S'): 0,
    ('F', 'N'): -3, ('S', 'R'): -1, ('W', 'D'): -4, ('V', 'Y'): -1,
    ('W', 'L'): -2, ('H', 'R'): 0, ('W', 'H'): -2, ('H', 'N'): 1,
    ('W', 'T'): -2, ('T', 'T'): 5, ('S', 'F'): -2, ('W', 'P'): -4,
    ('L', 'D'): -4, ('B', 'I'): -3, ('L', 'H'): -3, ('S', 'N'): 1,
    ('B', 'T'): -1, ('L', 'L'): 4, ('Y', 'K'): -2, ('E', 'Q'): 2,
    ('Y', 'G'): -3, ('Z', 'S'): 0, ('Y', 'C'): -2, ('G', 'D'): -1,
    ('B', 'V'): -3, ('E', 'A'): -1, ('Y', 'W'): 2, ('E', 'E'): 5,
    ('Y', 'S'): -2, ('C', 'N'): -3, ('V', 'C'): -1, ('T', 'H'): -2,
    ('P', 'R'): -2, ('V', 'G'): -3, ('T', 'L'): -1, ('V', 'K'): -2,
    ('K', 'Q'): 1, ('R', 'A'): -1, ('I', 'R'): -3, ('T', 'D'): -1,
    ('P', 'F'): -4, ('I', 'N'): -3, ('K', 'I'): -3, ('M', 'D'): -3,
    ('V', 'W'): -3, ('W', 'W'): 11, ('M', 'H'): -2, ('P', 'N'): -2,
    ('K', 'A'): -1, ('M', 'L'): 2, ('K', 'E'): 1, ('Z', 'E'): 4,
    ('X', 'N'): -1, ('Z', 'A'): -1, ('Z', 'M'): -1, ('X', 'F'): -1,
    ('K', 'C'): -3, ('B', 'Q'): 0, ('X', 'B'): -1, ('B', 'M'): -3,
    ('F', 'C'): -2, ('Z', 'Q'): 3, ('X', 'Z'): -1, ('F', 'G'): -3,
    ('B', 'E'): 1, ('X', 'V'): -1, ('F', 'K'): -3, ('B', 'A'): -2,
    ('X', 'R'): -1, ('D', 'D'): 6, ('W', 'G'): -2, ('Z', 'F'): -3,
    ('S', 'Q'): 0, ('W', 'C'): -2, ('W', 'K'): -3, ('H', 'Q'): 0,
    ('L', 'C'): -1, ('W', 'N'): -4, ('S', 'A'): 1, ('L', 'G'): -4,
    ('W', 'S'): -3, ('S', 'E'): 0, ('H', 'E'): 0, ('S', 'I'): -2,
    ('H', 'A'): -2, ('S', 'M'): -1, ('Y', 'L'): -1, ('Y', 'H'): 2,
    ('Y', 'D'): -3, ('E', 'R'): 0, ('X', 'P'): -2, ('G', 'G'): 6,
    ('G', 'C'): -3, ('E', 'N'): 0, ('Y', 'T'): -2, ('Y', 'P'): -3,
    ('T', 'K'): -1, ('A', 'A'): 4, ('P', 'Q'): -1, ('T', 'C'): -1,
    ('V', 'H'): -3, ('T', 'G'): -2, ('I', 'Q'): -3, ('Z', 'T'): -1,
    ('C', 'R'): -3, ('V', 'P'): -2, ('P', 'E'): -1, ('M', 'C'): -1,
    ('K', 'N'): 0, ('I', 'I'): 4, ('P', 'A'): -1, ('M', 'G'): -3,
    ('T', 'S'): 1, ('I', 'E'): -3, ('P', 'M'): -2, ('M', 'K'): -1,
    ('I', 'A'): -1, ('P', 'I'): -3, ('R', 'R'): 5, ('X', 'M'): -1,
    ('L', 'I'): 2, ('X', 'I'): -1, ('Z', 'B'): 1, ('X', 'E'): -1,
    ('Z', 'N'): 0, ('X', 'A'): 0, ('B', 'R'): -1, ('B', 'N'): 3,
    ('F', 'D'): -3, ('X', 'Y'): -1, ('Z', 'R'): 0, ('F', 'H'): -1,
    ('B', 'F'): -3, ('F', 'L'): 0, ('X', 'Q'): -1, ('B', 'B'): 4
}

def insert_gap(sequence: str, position: int) -> str:
    """Insert a gap ('-') into the sequence at the specified position."""
    return sequence[:position] + "-" + sequence[position:]

def global_alignment_affine(seq1: str, seq2: str, gap_open_penalty: int = -11, gap_extend_penalty: int = -1) -> Tuple[int, str, str]:
    """
    Perform global sequence alignment with affine gap penalty.
    
    Args:
    seq1 (str): First sequence to align
    seq2 (str): Second sequence to align
    gap_open_penalty (int): Penalty for opening a gap
    gap_extend_penalty (int): Penalty for extending a gap
    
    Returns:
    Tuple[int, str, str]: Alignment score and aligned sequences
    """
    scoring_matrix: Dict[Tuple[str, str], int] = BLOSUM62
    match_score: Dict[Tuple[int, int], int] = {}
    gap_seq1_score: Dict[Tuple[int, int], int] = {}
    gap_seq2_score: Dict[Tuple[int, int], int] = {}
    prev_match: Dict[Tuple[int, int], int] = {}
    prev_gap_seq1: Dict[Tuple[int, int], int] = {}
    prev_gap_seq2: Dict[Tuple[int, int], int] = {}

    # Initialize matrices
    gap_seq1_score[0, 0] = match_score[0, 0] = gap_seq2_score[0, 0] = 0
    for i in range(1, len(seq1) + 1):
        gap_seq1_score[i, 0] = gap_open_penalty + (i - 1) * gap_extend_penalty
        match_score[i, 0] = gap_open_penalty + (i - 1) * gap_extend_penalty
        gap_seq2_score[i, 0] = gap_open_penalty * 10  # Large penalty to avoid this case
    for j in range(1, len(seq2) + 1):
        gap_seq2_score[0, j] = gap_open_penalty + (j - 1) * gap_extend_penalty
        match_score[0, j] = gap_open_penalty + (j - 1) * gap_extend_penalty
        gap_seq1_score[0, j] = gap_open_penalty * 10  # Large penalty to avoid this case

    # Fill matrices
    for i in range(1, len(seq1) + 1):
        for j in range(1, len(seq2) + 1):
            # Calculate scores for gap in seq1
            gap_seq1_options: List[int] = [
                gap_seq1_score[i - 1, j] + gap_extend_penalty,
                match_score[i - 1, j] + gap_open_penalty
            ]
            gap_seq1_score[i, j] = max(gap_seq1_options)
            prev_gap_seq1[i, j] = gap_seq1_options.index(gap_seq1_score[i, j])

            # Calculate scores for gap in seq2
            gap_seq2_options: List[int] = [
                gap_seq2_score[i, j - 1] + gap_extend_penalty,
                match_score[i, j - 1] + gap_open_penalty
            ]
            gap_seq2_score[i, j] = max(gap_seq2_options)
            prev_gap_seq2[i, j] = gap_seq2_options.index(gap_seq2_score[i, j])

            # Calculate match/mismatch score
            blosum_score: int = scoring_matrix.get((seq1[i-1], seq2[j-1]), scoring_matrix.get((seq2[j-1], seq1[i-1]), 0))
            match_options: List[int] = [
                gap_seq1_score[i, j],
                match_score[i - 1, j - 1] + blosum_score,
                gap_seq2_score[i, j]
            ]
            match_score[i, j] = max(match_options)
            prev_match[i, j] = match_options.index(match_score[i, j])

    # Traceback
    i, j = len(seq1), len(seq2)
    aligned_seq1, aligned_seq2 = seq1, seq2

    scores: List[int] = [gap_seq1_score[i, j], match_score[i, j], gap_seq2_score[i, j]]
    max_score: int = max(scores)
    current_matrix: int = scores.index(max_score)

    while i * j != 0:
        if current_matrix == 0:  # In gap_seq1_score matrix
            if prev_gap_seq1[i, j] == 1:
                current_matrix = 1
            i -= 1
            aligned_seq2 = insert_gap(aligned_seq2, j)
        elif current_matrix == 1:  # In match_score matrix
            if prev_match[i, j] == 1:
                i -= 1
                j -= 1
            else:
                current_matrix = prev_match[i, j]
        else:  # In gap_seq2_score matrix
            if prev_gap_seq2[i, j] == 1:
                current_matrix = 1
            j -= 1
            aligned_seq1 = insert_gap(aligned_seq1, i)

    # Handle remaining overhangs
    while i > 0:
        aligned_seq2 = insert_gap(aligned_seq2, 0)
        i -= 1
    while j > 0:
        aligned_seq1 = insert_gap(aligned_seq1, 0)
        j -= 1

    return max_score, aligned_seq1, aligned_seq2

# Sample usage
sample_input: str = """
PRTEINS
PRTWPSEIN
"""

seq1, seq2 = sample_input.strip().split("\n")
alignment_score, aligned_seq1, aligned_seq2 = global_alignment_affine(seq1, seq2)
print(alignment_score, aligned_seq1, aligned_seq2, sep="\n")

58 Find a Middle Edge in an Alignment Graph in Linear Space

Middle Edge in Linear Space Problem. Find a middle edge in the alignment graph in linear space.

Given: Two amino acid strings.

Return: A middle edge in the alignment graph of these strings, where the optimal path is defined by the BLOSUM62 scoring matrix and a linear indel penalty equal to 5. Return the middle edge in the form”(ij) (kl)“, where (ij) connects to (kl).

58.1 Sample Dataset

PLEASANTLY
MEASNLY

58.2 Sample Output

(4, 3) (5, 4)

58.3 Solution

from math import floor
from typing import Dict, Tuple, List

BLOSUM62: Dict[Tuple[str, str], int] = {
    ('W', 'F'): 1, ('L', 'R'): -2, ('S', 'P'): -1, ('V', 'T'): 0,
    ('Q', 'Q'): 5, ('N', 'A'): -2, ('Z', 'Y'): -2, ('W', 'R'): -3,
    ('Q', 'A'): -1, ('S', 'D'): 0, ('H', 'H'): 8, ('S', 'H'): -1,
    ('H', 'D'): -1, ('L', 'N'): -3, ('W', 'A'): -3, ('Y', 'M'): -1,
    ('G', 'R'): -2, ('Y', 'I'): -1, ('Y', 'E'): -2, ('B', 'Y'): -3,
    ('Y', 'A'): -2, ('V', 'D'): -3, ('B', 'S'): 0, ('Y', 'Y'): 7,
    ('G', 'N'): 0, ('E', 'C'): -4, ('Y', 'Q'): -1, ('Z', 'Z'): 4,
    ('V', 'A'): 0, ('C', 'C'): 9, ('M', 'R'): -1, ('V', 'E'): -2,
    ('T', 'N'): 0, ('P', 'P'): 7, ('V', 'I'): 3, ('V', 'S'): -2,
    ('Z', 'P'): -1, ('V', 'M'): 1, ('T', 'F'): -2, ('V', 'Q'): -2,
    ('K', 'K'): 5, ('P', 'D'): -1, ('I', 'H'): -3, ('I', 'D'): -3,
    ('T', 'R'): -1, ('P', 'L'): -3, ('K', 'G'): -2, ('M', 'N'): -2,
    ('P', 'H'): -2, ('F', 'Q'): -3, ('Z', 'G'): -2, ('X', 'L'): -1,
    ('T', 'M'): -1, ('Z', 'C'): -3, ('X', 'H'): -1, ('D', 'R'): -2,
    ('B', 'W'): -4, ('X', 'D'): -1, ('Z', 'K'): 1, ('F', 'A'): -2,
    ('Z', 'W'): -3, ('F', 'E'): -3, ('D', 'N'): 1, ('B', 'K'): 0,
    ('X', 'X'): -1, ('F', 'I'): 0, ('B', 'G'): -1, ('X', 'T'): 0,
    ('F', 'M'): 0, ('B', 'C'): -3, ('Z', 'I'): -3, ('Z', 'V'): -2,
    ('S', 'S'): 4, ('L', 'Q'): -2, ('W', 'E'): -3, ('Q', 'R'): 1,
    ('N', 'N'): 6, ('W', 'M'): -1, ('Q', 'C'): -3, ('W', 'I'): -3,
    ('S', 'C'): -1, ('L', 'A'): -1, ('S', 'G'): 0, ('L', 'E'): -3,
    ('W', 'Q'): -2, ('H', 'G'): -2, ('S', 'K'): 0, ('Q', 'N'): 0,
    ('N', 'R'): 0, ('H', 'C'): -3, ('Y', 'N'): -2, ('G', 'Q'): -2,
    ('Y', 'F'): 3, ('C', 'A'): 0, ('V', 'L'): 1, ('G', 'E'): -2,
    ('G', 'A'): 0, ('K', 'R'): 2, ('E', 'D'): 2, ('Y', 'R'): -2,
    ('M', 'Q'): 0, ('T', 'I'): -1, ('C', 'D'): -3, ('V', 'F'): -1,
    ('T', 'A'): 0, ('T', 'P'): -1, ('B', 'P'): -2, ('T', 'E'): -1,
    ('V', 'N'): -3, ('P', 'G'): -2, ('M', 'A'): -1, ('K', 'H'): -1,
    ('V', 'R'): -3, ('P', 'C'): -3, ('M', 'E'): -2, ('K', 'L'): -2,
    ('V', 'V'): 4, ('M', 'I'): 1, ('T', 'Q'): -1, ('I', 'G'): -4,
    ('P', 'K'): -1, ('M', 'M'): 5, ('K', 'D'): -1, ('I', 'C'): -1,
    ('Z', 'D'): 1, ('F', 'R'): -3, ('X', 'K'): -1, ('Q', 'D'): 0,
    ('X', 'G'): -1, ('Z', 'L'): -3, ('X', 'C'): -2, ('Z', 'H'): 0,
    ('B', 'L'): -4, ('B', 'H'): 0, ('F', 'F'): 6, ('X', 'W'): -2,
    ('B', 'D'): 4, ('D', 'A'): -2, ('S', 'L'): -2, ('X', 'S'): 0,
    ('F', 'N'): -3, ('S', 'R'): -1, ('W', 'D'): -4, ('V', 'Y'): -1,
    ('W', 'L'): -2, ('H', 'R'): 0, ('W', 'H'): -2, ('H', 'N'): 1,
    ('W', 'T'): -2, ('T', 'T'): 5, ('S', 'F'): -2, ('W', 'P'): -4,
    ('L', 'D'): -4, ('B', 'I'): -3, ('L', 'H'): -3, ('S', 'N'): 1,
    ('B', 'T'): -1, ('L', 'L'): 4, ('Y', 'K'): -2, ('E', 'Q'): 2,
    ('Y', 'G'): -3, ('Z', 'S'): 0, ('Y', 'C'): -2, ('G', 'D'): -1,
    ('B', 'V'): -3, ('E', 'A'): -1, ('Y', 'W'): 2, ('E', 'E'): 5,
    ('Y', 'S'): -2, ('C', 'N'): -3, ('V', 'C'): -1, ('T', 'H'): -2,
    ('P', 'R'): -2, ('V', 'G'): -3, ('T', 'L'): -1, ('V', 'K'): -2,
    ('K', 'Q'): 1, ('R', 'A'): -1, ('I', 'R'): -3, ('T', 'D'): -1,
    ('P', 'F'): -4, ('I', 'N'): -3, ('K', 'I'): -3, ('M', 'D'): -3,
    ('V', 'W'): -3, ('W', 'W'): 11, ('M', 'H'): -2, ('P', 'N'): -2,
    ('K', 'A'): -1, ('M', 'L'): 2, ('K', 'E'): 1, ('Z', 'E'): 4,
    ('X', 'N'): -1, ('Z', 'A'): -1, ('Z', 'M'): -1, ('X', 'F'): -1,
    ('K', 'C'): -3, ('B', 'Q'): 0, ('X', 'B'): -1, ('B', 'M'): -3,
    ('F', 'C'): -2, ('Z', 'Q'): 3, ('X', 'Z'): -1, ('F', 'G'): -3,
    ('B', 'E'): 1, ('X', 'V'): -1, ('F', 'K'): -3, ('B', 'A'): -2,
    ('X', 'R'): -1, ('D', 'D'): 6, ('W', 'G'): -2, ('Z', 'F'): -3,
    ('S', 'Q'): 0, ('W', 'C'): -2, ('W', 'K'): -3, ('H', 'Q'): 0,
    ('L', 'C'): -1, ('W', 'N'): -4, ('S', 'A'): 1, ('L', 'G'): -4,
    ('W', 'S'): -3, ('S', 'E'): 0, ('H', 'E'): 0, ('S', 'I'): -2,
    ('H', 'A'): -2, ('S', 'M'): -1, ('Y', 'L'): -1, ('Y', 'H'): 2,
    ('Y', 'D'): -3, ('E', 'R'): 0, ('X', 'P'): -2, ('G', 'G'): 6,
    ('G', 'C'): -3, ('E', 'N'): 0, ('Y', 'T'): -2, ('Y', 'P'): -3,
    ('T', 'K'): -1, ('A', 'A'): 4, ('P', 'Q'): -1, ('T', 'C'): -1,
    ('V', 'H'): -3, ('T', 'G'): -2, ('I', 'Q'): -3, ('Z', 'T'): -1,
    ('C', 'R'): -3, ('V', 'P'): -2, ('P', 'E'): -1, ('M', 'C'): -1,
    ('K', 'N'): 0, ('I', 'I'): 4, ('P', 'A'): -1, ('M', 'G'): -3,
    ('T', 'S'): 1, ('I', 'E'): -3, ('P', 'M'): -2, ('M', 'K'): -1,
    ('I', 'A'): -1, ('P', 'I'): -3, ('R', 'R'): 5, ('X', 'M'): -1,
    ('L', 'I'): 2, ('X', 'I'): -1, ('Z', 'B'): 1, ('X', 'E'): -1,
    ('Z', 'N'): 0, ('X', 'A'): 0, ('B', 'R'): -1, ('B', 'N'): 3,
    ('F', 'D'): -3, ('X', 'Y'): -1, ('Z', 'R'): 0, ('F', 'H'): -1,
    ('B', 'F'): -3, ('F', 'L'): 0, ('X', 'Q'): -1, ('B', 'B'): 4
}

def calculate_alignment_scores(
    sequence1: str,
    sequence2: str,
    scoring_matrix: Dict[Tuple[str, str], int],
    gap_penalty: int
) -> Tuple[List[int], List[int]]:
    current_scores = list(range(0, (len(sequence1) + 1) * gap_penalty, gap_penalty))
    backtrack = [0] * (len(sequence1) + 1)
    
    for j in range(1, len(sequence2) + 1):
        previous_scores = current_scores[:]
        current_scores[0] = previous_scores[0] + gap_penalty
        for i in range(1, len(sequence1) + 1):
            options = [
                previous_scores[i] + gap_penalty,
                current_scores[i - 1] + gap_penalty,
                previous_scores[i - 1] + scoring_matrix.get(
                    (sequence1[i - 1], sequence2[j - 1]),
                    scoring_matrix.get((sequence2[j - 1], sequence1[i - 1]), 0)
                ),
            ]
            current_scores[i] = max(options)
            backtrack[i] = options.index(current_scores[i])
    
    return current_scores, backtrack

def find_middle_edge(
    sequence1: str,
    sequence2: str,
    scoring_matrix: Dict[Tuple[str, str], int],
    gap_penalty: int
) -> Tuple[Tuple[int, int], Tuple[int, int]]:
    midpoint = floor(len(sequence2) / 2)
    
    forward_scores, _ = calculate_alignment_scores(
        sequence1, sequence2[:midpoint], scoring_matrix, gap_penalty
    )
    reverse_scores, reverse_backtrack = calculate_alignment_scores(
        sequence1[::-1], sequence2[midpoint:][::-1], scoring_matrix, gap_penalty
    )
    
    total_scores = [f + r for f, r in zip(forward_scores, reverse_scores[::-1])]
    best_score_index = total_scores.index(max(total_scores))
    
    start_node = (best_score_index, midpoint)
    possible_moves = [
        (start_node[0], start_node[1] + 1),
        (start_node[0] + 1, start_node[1]),
        (start_node[0] + 1, start_node[1] + 1)
    ]
    end_node = possible_moves[reverse_backtrack[::-1][best_score_index]]
    
    return (start_node, end_node)

# Sample usage
sample_input: str = """
PLEASANTLY
MEASNLY
"""

sequence1, sequence2 = sample_input.strip().split("\n")
result = find_middle_edge(sequence1, sequence2, BLOSUM62, -5)
print(result)

59 Align Two Strings Using Linear Space

Global Alignment in Linear Space Problem. Find the highest-scoring alignment between two strings using a scoring matrix in linear space.

Given: Two long amino acid strings (of length approximately 10,000).

Return: The maximum alignment score of these strings, followed by an alignment achieving this maximum score. Use the BLOSUM62 scoring matrix and indel penalty σ = 5.

59.1 Sample Dataset

PLEASANTLY
MEANLY

59.2 Sample Output

8
PLEASANTLY
-MEA--N-LY

59.3 Solution

from math import floor
from typing import Dict, Tuple, List

BLOSUM62: Dict[Tuple[str, str], int] = {
    ('W', 'F'): 1, ('L', 'R'): -2, ('S', 'P'): -1, ('V', 'T'): 0,
    ('Q', 'Q'): 5, ('N', 'A'): -2, ('Z', 'Y'): -2, ('W', 'R'): -3,
    ('Q', 'A'): -1, ('S', 'D'): 0, ('H', 'H'): 8, ('S', 'H'): -1,
    ('H', 'D'): -1, ('L', 'N'): -3, ('W', 'A'): -3, ('Y', 'M'): -1,
    ('G', 'R'): -2, ('Y', 'I'): -1, ('Y', 'E'): -2, ('B', 'Y'): -3,
    ('Y', 'A'): -2, ('V', 'D'): -3, ('B', 'S'): 0, ('Y', 'Y'): 7,
    ('G', 'N'): 0, ('E', 'C'): -4, ('Y', 'Q'): -1, ('Z', 'Z'): 4,
    ('V', 'A'): 0, ('C', 'C'): 9, ('M', 'R'): -1, ('V', 'E'): -2,
    ('T', 'N'): 0, ('P', 'P'): 7, ('V', 'I'): 3, ('V', 'S'): -2,
    ('Z', 'P'): -1, ('V', 'M'): 1, ('T', 'F'): -2, ('V', 'Q'): -2,
    ('K', 'K'): 5, ('P', 'D'): -1, ('I', 'H'): -3, ('I', 'D'): -3,
    ('T', 'R'): -1, ('P', 'L'): -3, ('K', 'G'): -2, ('M', 'N'): -2,
    ('P', 'H'): -2, ('F', 'Q'): -3, ('Z', 'G'): -2, ('X', 'L'): -1,
    ('T', 'M'): -1, ('Z', 'C'): -3, ('X', 'H'): -1, ('D', 'R'): -2,
    ('B', 'W'): -4, ('X', 'D'): -1, ('Z', 'K'): 1, ('F', 'A'): -2,
    ('Z', 'W'): -3, ('F', 'E'): -3, ('D', 'N'): 1, ('B', 'K'): 0,
    ('X', 'X'): -1, ('F', 'I'): 0, ('B', 'G'): -1, ('X', 'T'): 0,
    ('F', 'M'): 0, ('B', 'C'): -3, ('Z', 'I'): -3, ('Z', 'V'): -2,
    ('S', 'S'): 4, ('L', 'Q'): -2, ('W', 'E'): -3, ('Q', 'R'): 1,
    ('N', 'N'): 6, ('W', 'M'): -1, ('Q', 'C'): -3, ('W', 'I'): -3,
    ('S', 'C'): -1, ('L', 'A'): -1, ('S', 'G'): 0, ('L', 'E'): -3,
    ('W', 'Q'): -2, ('H', 'G'): -2, ('S', 'K'): 0, ('Q', 'N'): 0,
    ('N', 'R'): 0, ('H', 'C'): -3, ('Y', 'N'): -2, ('G', 'Q'): -2,
    ('Y', 'F'): 3, ('C', 'A'): 0, ('V', 'L'): 1, ('G', 'E'): -2,
    ('G', 'A'): 0, ('K', 'R'): 2, ('E', 'D'): 2, ('Y', 'R'): -2,
    ('M', 'Q'): 0, ('T', 'I'): -1, ('C', 'D'): -3, ('V', 'F'): -1,
    ('T', 'A'): 0, ('T', 'P'): -1, ('B', 'P'): -2, ('T', 'E'): -1,
    ('V', 'N'): -3, ('P', 'G'): -2, ('M', 'A'): -1, ('K', 'H'): -1,
    ('V', 'R'): -3, ('P', 'C'): -3, ('M', 'E'): -2, ('K', 'L'): -2,
    ('V', 'V'): 4, ('M', 'I'): 1, ('T', 'Q'): -1, ('I', 'G'): -4,
    ('P', 'K'): -1, ('M', 'M'): 5, ('K', 'D'): -1, ('I', 'C'): -1,
    ('Z', 'D'): 1, ('F', 'R'): -3, ('X', 'K'): -1, ('Q', 'D'): 0,
    ('X', 'G'): -1, ('Z', 'L'): -3, ('X', 'C'): -2, ('Z', 'H'): 0,
    ('B', 'L'): -4, ('B', 'H'): 0, ('F', 'F'): 6, ('X', 'W'): -2,
    ('B', 'D'): 4, ('D', 'A'): -2, ('S', 'L'): -2, ('X', 'S'): 0,
    ('F', 'N'): -3, ('S', 'R'): -1, ('W', 'D'): -4, ('V', 'Y'): -1,
    ('W', 'L'): -2, ('H', 'R'): 0, ('W', 'H'): -2, ('H', 'N'): 1,
    ('W', 'T'): -2, ('T', 'T'): 5, ('S', 'F'): -2, ('W', 'P'): -4,
    ('L', 'D'): -4, ('B', 'I'): -3, ('L', 'H'): -3, ('S', 'N'): 1,
    ('B', 'T'): -1, ('L', 'L'): 4, ('Y', 'K'): -2, ('E', 'Q'): 2,
    ('Y', 'G'): -3, ('Z', 'S'): 0, ('Y', 'C'): -2, ('G', 'D'): -1,
    ('B', 'V'): -3, ('E', 'A'): -1, ('Y', 'W'): 2, ('E', 'E'): 5,
    ('Y', 'S'): -2, ('C', 'N'): -3, ('V', 'C'): -1, ('T', 'H'): -2,
    ('P', 'R'): -2, ('V', 'G'): -3, ('T', 'L'): -1, ('V', 'K'): -2,
    ('K', 'Q'): 1, ('R', 'A'): -1, ('I', 'R'): -3, ('T', 'D'): -1,
    ('P', 'F'): -4, ('I', 'N'): -3, ('K', 'I'): -3, ('M', 'D'): -3,
    ('V', 'W'): -3, ('W', 'W'): 11, ('M', 'H'): -2, ('P', 'N'): -2,
    ('K', 'A'): -1, ('M', 'L'): 2, ('K', 'E'): 1, ('Z', 'E'): 4,
    ('X', 'N'): -1, ('Z', 'A'): -1, ('Z', 'M'): -1, ('X', 'F'): -1,
    ('K', 'C'): -3, ('B', 'Q'): 0, ('X', 'B'): -1, ('B', 'M'): -3,
    ('F', 'C'): -2, ('Z', 'Q'): 3, ('X', 'Z'): -1, ('F', 'G'): -3,
    ('B', 'E'): 1, ('X', 'V'): -1, ('F', 'K'): -3, ('B', 'A'): -2,
    ('X', 'R'): -1, ('D', 'D'): 6, ('W', 'G'): -2, ('Z', 'F'): -3,
    ('S', 'Q'): 0, ('W', 'C'): -2, ('W', 'K'): -3, ('H', 'Q'): 0,
    ('L', 'C'): -1, ('W', 'N'): -4, ('S', 'A'): 1, ('L', 'G'): -4,
    ('W', 'S'): -3, ('S', 'E'): 0, ('H', 'E'): 0, ('S', 'I'): -2,
    ('H', 'A'): -2, ('S', 'M'): -1, ('Y', 'L'): -1, ('Y', 'H'): 2,
    ('Y', 'D'): -3, ('E', 'R'): 0, ('X', 'P'): -2, ('G', 'G'): 6,
    ('G', 'C'): -3, ('E', 'N'): 0, ('Y', 'T'): -2, ('Y', 'P'): -3,
    ('T', 'K'): -1, ('A', 'A'): 4, ('P', 'Q'): -1, ('T', 'C'): -1,
    ('V', 'H'): -3, ('T', 'G'): -2, ('I', 'Q'): -3, ('Z', 'T'): -1,
    ('C', 'R'): -3, ('V', 'P'): -2, ('P', 'E'): -1, ('M', 'C'): -1,
    ('K', 'N'): 0, ('I', 'I'): 4, ('P', 'A'): -1, ('M', 'G'): -3,
    ('T', 'S'): 1, ('I', 'E'): -3, ('P', 'M'): -2, ('M', 'K'): -1,
    ('I', 'A'): -1, ('P', 'I'): -3, ('R', 'R'): 5, ('X', 'M'): -1,
    ('L', 'I'): 2, ('X', 'I'): -1, ('Z', 'B'): 1, ('X', 'E'): -1,
    ('Z', 'N'): 0, ('X', 'A'): 0, ('B', 'R'): -1, ('B', 'N'): 3,
    ('F', 'D'): -3, ('X', 'Y'): -1, ('Z', 'R'): 0, ('F', 'H'): -1,
    ('B', 'F'): -3, ('F', 'L'): 0, ('X', 'Q'): -1, ('B', 'B'): 4
}

def calculate_alignment_scores(
    sequence1: str,
    sequence2: str,
    scoring_matrix: Dict[Tuple[str, str], int],
    gap_penalty: int
) -> Tuple[List[int], List[int]]:
    current_scores = list(range(0, (len(sequence1) + 1) * gap_penalty, gap_penalty))
    backtrack = [0] * (len(sequence1) + 1)
    
    for j in range(1, len(sequence2) + 1):
        previous_scores = current_scores[:]
        current_scores[0] = previous_scores[0] + gap_penalty
        for i in range(1, len(sequence1) + 1):
            options = [
                previous_scores[i] + gap_penalty,
                current_scores[i - 1] + gap_penalty,
                previous_scores[i - 1] + scoring_matrix.get(
                    (sequence1[i - 1], sequence2[j - 1]),
                    scoring_matrix.get((sequence2[j - 1], sequence1[i - 1]), 0)
                ),
            ]
            current_scores[i] = max(options)
            backtrack[i] = options.index(current_scores[i])
    
    return current_scores, backtrack

def find_middle_edge(
    sequence1: str,
    sequence2: str,
    scoring_matrix: Dict[Tuple[str, str], int],
    gap_penalty: int
) -> Tuple[Tuple[int, int], Tuple[int, int]]:
    midpoint = floor(len(sequence2) / 2)
    
    forward_scores, _ = calculate_alignment_scores(
        sequence1, sequence2[:midpoint], scoring_matrix, gap_penalty
    )
    reverse_scores, reverse_backtrack = calculate_alignment_scores(
        sequence1[::-1], sequence2[midpoint:][::-1], scoring_matrix, gap_penalty
    )
    
    total_scores = [f + r for f, r in zip(forward_scores, reverse_scores[::-1])]
    best_score_index = total_scores.index(max(total_scores))
    
    start_node = (best_score_index, midpoint)
    possible_moves = [
        (start_node[0], start_node[1] + 1),
        (start_node[0] + 1, start_node[1]),
        (start_node[0] + 1, start_node[1] + 1)
    ]
    end_node = possible_moves[reverse_backtrack[::-1][best_score_index]]
    
    return (start_node, end_node)

def calculate_alignment_score(
    aligned_seq1: str,
    aligned_seq2: str,
    scoring_matrix: Dict[Tuple[str, str], int],
    gap_penalty: int
) -> int:
    return sum(
        gap_penalty if aligned_seq1[i] == "-" or aligned_seq2[i] == "-" else
        scoring_matrix.get((aligned_seq1[i], aligned_seq2[i]),
                           scoring_matrix.get((aligned_seq2[i], aligned_seq1[i]), 0))
        for i in range(len(aligned_seq1))
    )

def find_alignment_path(
    sequence1: str,
    sequence2: str,
    scoring_matrix: Dict[Tuple[str, str], int],
    gap_penalty: int
) -> str:
    def linear_space_alignment(top: int, bottom: int, left: int, right: int) -> str:
        if left == right:
            return "↓" * (bottom - top)
        elif top == bottom:
            return "→" * (right - left)
        else:
            ((i, j), (i2, j2)) = find_middle_edge(
                sequence1[top:bottom], sequence2[left:right], scoring_matrix, gap_penalty
            )
            edge = "↓" if j == j2 else "→" if i == i2 else "↘"
            return (
                linear_space_alignment(top, i + top, left, j + left) +
                edge +
                linear_space_alignment(i2 + top, bottom, j2 + left, right)
            )

    return linear_space_alignment(0, len(sequence1), 0, len(sequence2))

def construct_alignment(
    alignment_path: str,
    sequence1: str,
    sequence2: str
) -> Tuple[str, str]:
    aligned_seq1, aligned_seq2 = "", ""
    i, j = 0, 0
    for direction in alignment_path:
        if direction == "↘":
            aligned_seq1 += sequence1[i]
            aligned_seq2 += sequence2[j]
            i += 1
            j += 1
        elif direction == "↓":
            aligned_seq1 += sequence1[i]
            aligned_seq2 += "-"
            i += 1
        else:
            aligned_seq1 += "-"
            aligned_seq2 += sequence2[j]
            j += 1
    return aligned_seq1, aligned_seq2

# Sample usage
sample_input: str = """
PLEASANTLY
MEANLY
"""

sequence1, sequence2 = sample_input.strip().split("\n")
scoring_matrix = BLOSUM62
alignment_path = find_alignment_path(sequence1, sequence2, scoring_matrix, -5)
aligned_seq1, aligned_seq2 = construct_alignment(alignment_path, sequence1, sequence2)
print(calculate_alignment_score(aligned_seq1, aligned_seq2, scoring_matrix, -5))
print(aligned_seq1, aligned_seq2, sep="\n")

60 Find a Highest-Scoring Multiple Sequence Alignment

Multiple Longest Common Subsequence Problem. Find a longest common subsequence of multiple strings.

Given: Three DNA strings.

Return: The maximum score of a multiple alignment of these three strings, followed by a multiple alignment of the three strings achieving this maximum. Use a scoring function in which the score of an alignment column is 1 if all three symbols are identical and 0 otherwise. (If more than one multiple alignment achieve the maximum, you may return any one.)

60.1 Sample Dataset

ATATCCG
TCCGA
ATGTACTG

60.2 Sample Output

3
ATATCC-G-
---TCC-GA
ATGTACTG-

60.3 Solution

from itertools import product
from typing import List, Tuple, Dict

# Check if the coordinates are non-negative in the alignment matrix
def is_valid_coordinate(pointer: Tuple[int, ...], position: Tuple[int, ...]) -> bool:
    return all([i >= 0 for i in get_previous_position(position, pointer)])

# Get the previous position given a current position and a pointer
def get_previous_position(position: Tuple[int, ...], pointer: Tuple[int, ...]) -> Tuple[int, ...]:
    return tuple([p + d for p, d in zip(position, pointer)])

# Calculate the score for a given position and pointer
def calculate_score(sequences: List[str], position: Tuple[int, ...], pointer: Tuple[int, ...]) -> int:
    if pointer == (-1, -1, -1):
        bases = [sequences[i][j] for i, j in enumerate(get_previous_position(position, pointer))]
        return int(all(base == bases[0] for base in bases))
    else:
        return 0

# Generate possible previous cell pointers
def generate_moves(dimension: int) -> List[Tuple[int, ...]]:
    return list(product([0, -1], repeat=dimension))[1:]

def multiple_sequence_alignment(sequences: List[str]) -> Tuple[int, str, str, str]:
    scores: Dict[Tuple[int, ...], int] = {}
    pointers: Dict[Tuple[int, ...], Tuple[int, ...]] = {}
    scores[(0, 0, 0)] = 0
    
    ranges = [range(0, len(seq) + 1) for seq in sequences]
    
    for position in product(*ranges):
        valid_pointers = list(filter(lambda x: is_valid_coordinate(x, position), generate_moves(3)))
        if not valid_pointers:
            continue
        
        possible_scores = [scores[get_previous_position(position, ptr)] + calculate_score(sequences, position, ptr) for ptr in valid_pointers]
        scores[position] = max(possible_scores)
        pointers[position] = valid_pointers[possible_scores.index(max(possible_scores))]

    # Traceback to recover alignment
    total_score = scores[position]
    aligned_sequences = ["", "", ""]
    
    while any([x > 0 for x in position]):
        pointer = pointers[position]
        for i, seq in enumerate(sequences):
            aligned_sequences[i] += seq[position[i] - 1] if pointer[i] == -1 else "-"
        position = get_previous_position(position, pointer)

    return (total_score, 
            aligned_sequences[0][::-1], 
            aligned_sequences[1][::-1], 
            aligned_sequences[2][::-1])

sample_input = """
ATATCCG
TCCGA
ATGTACTG
"""

sequences = sample_input.strip().split("\n")
alignment_score, seq1, seq2, seq3 = multiple_sequence_alignment(sequences)
print(alignment_score)
print(seq1)
print(seq2)
print(seq3)

61 Find a Topological Ordering of a DAG

Topological Ordering Problem. Find a topological ordering of a directed acyclic graph.

Given: The adjacency list of a graph (with nodes represented by integers).

Return: A topological ordering of this graph.

61.1 Sample Dataset

1 -> 2
2 -> 3
4 -> 2
5 -> 3

61.2 Sample Output

1, 4, 5, 2, 3

61.3 Solution

from typing import Dict, List, Tuple, Set

NodeLabel = str
Graph = Dict[NodeLabel, List[NodeLabel]]

def create_graph(edge_list: List[str]) -> Graph:
    graph: Graph = {}
    for edge in edge_list:
        source, targets = edge.split(" -> ")
        target_list = targets.split(",")
        if source not in graph:
            graph[source] = []
        graph[source].extend(target_list)
        for target in target_list:
            if target not in graph:
                graph[target] = []
    return graph

def depth_first_search(graph: Graph, node: NodeLabel, visited: Set[NodeLabel], stack: List[NodeLabel]) -> None:
    visited.add(node)
    for neighbor in graph.get(node, []):
        if neighbor not in visited:
            depth_first_search(graph, neighbor, visited, stack)
    stack.insert(0, node)

def topological_sort(graph: Graph) -> List[NodeLabel]:
    visited: Set[NodeLabel] = set()
    stack: List[NodeLabel] = []
    for node in graph:
        if node not in visited:
            depth_first_search(graph, node, visited, stack)
    return stack

def parse_input(input_text: str) -> List[str]:
    return input_text.strip().split("\n")

# Sample usage
sample_input = """
1 -> 2
2 -> 3
4 -> 2
5 -> 3
"""

edge_list = parse_input(sample_input)
graph = create_graph(edge_list)
sorted_nodes = topological_sort(graph)
print(", ".join(sorted_nodes))

62 Implement GreedySorting to Sort a Permutation by Reversals

Implement GreedySorting.

Given: A signed permutation P.

Return: The sequence of permutations corresponding to applying GreedySorting to P, ending with the identity permutation.

62.1 Sample Dataset

(-3 +4 +1 +5 -2)

62.2 Sample Output

(-1 -4 +3 +5 -2)
(+1 -4 +3 +5 -2)
(+1 +2 -5 -3 +4)
(+1 +2 +3 +5 +4)
(+1 +2 +3 -4 -5)
(+1 +2 +3 +4 -5)
(+1 +2 +3 +4 +5)

62.3 Solution

from typing import List, Tuple

def perform_k_sorting_reversal(permutation: List[int], k: int) -> List[int]:
    j = k
    while abs(permutation[j]) != k + 1:
        j += 1
    permutation[k:j+1] = [-x for x in reversed(permutation[k:j+1])]
    return permutation

def greedy_sorting(permutation: List[int]) -> List[List[int]]:
    reversal_sequence: List[List[int]] = []
    for k in range(len(permutation)):
        while permutation[k] != k + 1:
            permutation = perform_k_sorting_reversal(permutation, k)
            reversal_sequence.append(list(permutation))
    return reversal_sequence

def parse_permutation(input_text: str) -> List[int]:
    cleaned_input = input_text.strip().replace("(", "").replace(")", "")
    return [int(x) for x in cleaned_input.split()]

def format_permutation(permutation: List[int]) -> str:
    formatted_elements = [("+" if x > 0 else "") + str(x) for x in permutation]
    return "(" + " ".join(formatted_elements) + ")"

# Sample usage
sample_input = """
(-3 +4 +1 +5 -2)
"""

initial_permutation = parse_permutation(sample_input)
sorting_sequence = greedy_sorting(initial_permutation)

for permutation in sorting_sequence:
    print(format_permutation(permutation))

63 Compute the Number of Breakpoints in a Permutation

Number of Breakpoints Problem. Find the number of breakpoints in a permutation.

Given: A signed permutation P.

Return: The number of breakpoints in P.

63.1 Sample Dataset

(+3 +4 +5 -12 -8 -7 -6 +1 +2 +10 +9 -11 +13 +14)

63.2 Sample Output

8

63.3 Solution

from typing import List

def count_breakpoints(permutation: List[int]) -> int:
    augmented_permutation = [0] + permutation + [max(permutation) + 1]
    breakpoint_count = 0
    
    for i in range(1, len(augmented_permutation) - 1):
        if augmented_permutation[i] != augmented_permutation[i - 1] + 1:
            breakpoint_count += 1
    
    return breakpoint_count

sample_input = """
(+3 +4 +5 -12 -8 -7 -6 +1 +2 +10 +9 -11 +13 +14)
"""

permutation_string = sample_input.strip()
permutation_string = permutation_string.replace("(", "").replace(")", "")
permutation = [int(x) for x in permutation_string.split()]

print(count_breakpoints(permutation))

64 Compute the 2-Break Distance Between a Pair of Genomes

2-Break Distance Problem. Find the 2-break distance between two genomes.

Given: Two genomes with circular chromosomes on the same set of synteny blocks.

Return: The 2-break distance between these two genomes.

64.1 Sample Dataset

(+1 +2 +3 +4 +5 +6)
(+1 -3 -6 -5)(+2 -4)

64.2 Sample Output

3

64.3 Solution

import re
from collections import defaultdict
from typing import List, Dict, Set, DefaultDict

def find_component(start_node: int, graph: Dict[int, List[int]]) -> Set[int]:
    queue: List[int] = [start_node]
    visited: Set[int] = set()
    while queue:
        current_node = queue.pop(0)
        visited.add(current_node)
        for neighbor in graph[current_node]:
            if neighbor not in visited:
                queue.append(neighbor)
    return visited

def parse_genome_graph(genome_string: str) -> DefaultDict[int, List[int]]:
    genome_graph: DefaultDict[int, List[int]] = defaultdict(list)
    for component in re.findall(r"\((.+?)\)", genome_string):
        chromosome = list(map(int, component.split()))
        for i in range(len(chromosome) - 1):
            genome_graph[chromosome[i]].append(-chromosome[i + 1])
            genome_graph[-chromosome[i + 1]].append(chromosome[i])
        genome_graph[chromosome[-1]].append(-chromosome[0])
        genome_graph[-chromosome[0]].append(chromosome[-1])
    return genome_graph

def breakpoint_graph(genome1: DefaultDict[int, List[int]], genome2: DefaultDict[int, List[int]]) -> Dict[int, List[int]]:
    combined_graph: Dict[int, List[int]] = {}
    for node in genome1.keys():
        combined_graph[node] = genome1[node] + genome2[node]
    return combined_graph

def calculate_two_break_distance(genomes: List[DefaultDict[int, List[int]]]) -> int:
    combined_graph = breakpoint_graph(*genomes)
    nodes: Set[int] = set(combined_graph.keys())
    num_blocks = len(nodes) // 2
    num_components = 0
    while nodes:
        component = find_component(next(iter(nodes)), combined_graph)
        nodes -= component
        num_components += 1
    return num_blocks - num_components

sample_input = """
(+1 +2 +3 +4 +5 +6)
(+1 -3 -6 -5)(+2 -4)
"""

input_lines = sample_input.strip().split("\n")
genomes = [parse_genome_graph(genome_string) for genome_string in input_lines]
print(calculate_two_break_distance(genomes))

65 Find a Shortest Transformation of One Genome into Another by 2-Breaks

2-Break Sorting Problem. Find a shortest transformation of one genome into another by 2-breaks.

Given: Two genomes with circular chromosomes on the same set of synteny blocks.

Return: The sequence of genomes resulting from applying a shortest sequence of 2-breaks transforming one genome into the other.

65.1 Sample Dataset

(+1 -2 -3 +4)
(+1 +2 -4 -3)

65.2 Sample Output

(+1 -2 -3 +4)
(+1 +2 -3 +4)
(+1 +2 -4 +3)
(+1 +2 -4 -3)

65.3 Solution

import re
from collections import defaultdict
from typing import List, Dict, Set, Generator, DefaultDict

def find_component(start_node: int, graph: Dict[int, List[int]]) -> Set[int]:
    queue: List[int] = [start_node]
    visited: Set[int] = set()
    while queue:
        current_node = queue.pop(0)
        visited.add(current_node)
        for neighbor in graph[current_node]:
            if neighbor not in visited:
                queue.append(neighbor)
    return visited

def parse_genome_graph(genome_string: str) -> DefaultDict[int, List[int]]:
    genome_graph: DefaultDict[int, List[int]] = defaultdict(list)
    for component in re.findall(r"\((.+?)\)", genome_string):
        chromosome = list(map(int, component.split()))
        for i in range(len(chromosome) - 1):
            genome_graph[chromosome[i]].append(-chromosome[i + 1])
            genome_graph[-chromosome[i + 1]].append(chromosome[i])
        genome_graph[chromosome[-1]].append(-chromosome[0])
        genome_graph[-chromosome[0]].append(chromosome[-1])
    return genome_graph

def breakpoint_graph(genome1: DefaultDict[int, List[int]], genome2: DefaultDict[int, List[int]]) -> Dict[int, List[int]]:
    combined_graph: Dict[int, List[int]] = {}
    for node in genome1.keys():
        combined_graph[node] = genome1[node] + genome2[node]
    return combined_graph

def format_perm(perm: List[int]) -> str:
    return "(" + " ".join([f"{x:+}" for x in perm]) + ")"

def find_components(graph: Dict[int, List[int]]) -> Generator[Set[int], None, None]:
    nodes: Set[int] = set(graph.keys())
    while nodes:
        component = find_component(next(iter(nodes)), graph)
        nodes = nodes - component
        yield component

def non_trivial_cycle_nodes(graph: Dict[int, List[int]]) -> List[int] | None:
    for component in find_components(graph):
        if len(component) > 2:
            return list(component)
    return None

def find_genome_component(start_node: int, graph: Dict[int, List[int]]) -> List[int]:
    queue: List[int] = [start_node]
    visited: List[int] = []
    while queue:
        current_node = queue.pop(0)
        visited.append(current_node)
        for neighbor in graph[current_node]:
            if -neighbor not in visited:
                queue.append(-neighbor)
    return visited

def format_genome_graph(genome_graph: Dict[int, List[int]]) -> str:
    nodes: Set[int] = set(genome_graph.keys())
    components: List[List[int]] = []
    while nodes:
        component = find_genome_component(next(iter(nodes)), genome_graph)
        nodes = nodes - set(component)
        nodes = nodes - set(-x for x in component)
        components.append(component)
    return "".join([format_perm(c) for c in components])

def add_edge(graph: Dict[int, List[int]], node1: int, node2: int) -> None:
    graph[node1].append(node2)
    graph[node2].append(node1)

def del_edge(graph: Dict[int, List[int]], node1: int, node2: int) -> None:
    graph[node1].remove(node2)
    graph[node2].remove(node1)

def ba6d(genome1: DefaultDict[int, List[int]], genome2: DefaultDict[int, List[int]]) -> Generator[str, None, None]:
    combined_graph = breakpoint_graph(genome1, genome2)
    nodes = non_trivial_cycle_nodes(combined_graph)
    yield format_genome_graph(genome1)
    while nodes:
        j = nodes[0]
        i2 = genome2[nodes[0]][0]
        i = genome1[j][0]
        j2 = genome1[i2][0]

        del_edge(genome1, i, j)
        del_edge(genome1, i2, j2)
        add_edge(genome1, j, i2)
        add_edge(genome1, j2, i)

        yield format_genome_graph(genome1)
        combined_graph = breakpoint_graph(genome1, genome2)
        nodes = non_trivial_cycle_nodes(combined_graph)

sample_input = """
(+1 -2 -3 +4)
(+1 +2 -4 -3)
"""

genome1, genome2 = [parse_genome_graph(s) for s in sample_input.strip().split("\n")]
for genome in ba6d(genome1, genome2):
    print(genome)

66 Find All Shared k-mers of a Pair of Strings

Shared k-mers Problem. Given two strings, find all their shared k-mers.

Given: An integer k and two strings.

Return: All k-mers shared by these strings, in the form of ordered pairs (xy) corresponding to starting positions of these k-mers in the respective strings.

66.1 Sample Dataset

3
AAACTCATC
TTTCAAATC

66.2 Sample Output

(0, 4)
(0, 0)
(4, 2)
(6, 6)

66.3 Solution

import re
from typing import List, Tuple, Iterator

def reverse_complement(sequence: str) -> str:
    return sequence[::-1].translate(str.maketrans("ACGT", "TGCA"))

def find_overlapping_matches(pattern: str, sequence: str) -> Iterator[re.Match]:
    return re.finditer(rf"(?=({pattern}))", sequence)

def find_shared_kmers(kmer_length: int, sequence1: str, sequence2: str) -> Iterator[Tuple[int, int]]:
    for i in range(len(sequence1) - kmer_length + 1):
        kmer = sequence1[i : (i + kmer_length)]
        for current_sequence in [kmer, reverse_complement(kmer)]:
            matches = list(find_overlapping_matches(current_sequence, sequence2))
            for match in matches:
                yield (i, match.start())

# Sample usage
sample_input = """
3
AAACTCATC
TTTCAAATC
"""

kmer_length, sequence1, sequence2 = sample_input.strip().split("\n")
for match in find_shared_kmers(int(kmer_length), sequence1, sequence2):
    print(match)

67 Implement ChromosomeToCycle

Chromosome To Cycle Problem. Solve the Chromosome To Cycle Problem.

Given: A chromosome Chromosome containing n synteny blocks.

Return: The sequence Nodes of integers between 1 and 2_n_ resulting from applying ChromosomeToCycle to Chromosome.

67.1 Sample Dataset

(+1 -2 -3 +4)

67.2 Sample Output

(1 2 4 3 6 5 7 8)

67.3 Solution

from typing import List

def parse_permutation(permutation_string: str) -> List[int]:
    return list(map(int, permutation_string[1:-1].split()))

def chromosome_to_cycle(chromosome: List[int]) -> List[int]:
    nodes: List[int] = []
    for gene in chromosome:
        if gene > 0:
            nodes.extend([2 * gene - 1, 2 * gene])
        else:
            nodes.extend([-2 * gene, -2 * gene - 1])
    return nodes

def convert_chromosome_to_cycle(chromosome_string: str) -> List[int]:
    return chromosome_to_cycle(parse_permutation(chromosome_string))

def format_cycle(cycle: List[int]) -> str:
    return "(" + " ".join(map(str, cycle)) + ")"

sample_input: str = "(+1 -2 -3 +4)"

chromosome_string: str = sample_input.strip()
print(format_cycle(convert_chromosome_to_cycle(chromosome_string)))

68 Implement CycleToChromosome

Cycle To Chromosome Problem. Solve the Cycle to Chromosome Problem.

Given: A sequence Nodes of integers between 1 and 2_n_.

Return: The chromosome Chromosome containing n synteny blocks resulting from applying CycleToChromosome to Nodes.

68.1 Sample Dataset

(1 2 4 3 6 5 7 8)

68.2 Sample Output

(+1 -2 -3 +4)

68.3 Solution

from typing import List

def parse_cycle(cycle_string: str) -> List[int]:
    return list(map(int, cycle_string[1:-1].split()))

def format_chromosome(chromosome: List[int]) -> str:
    return "(" + " ".join([f"{gene:+}" for gene in chromosome]) + ")"

def cycle_to_chromosome(cycle: List[int]) -> List[int]:
    chromosome: List[int] = []
    for j1, j2 in zip(cycle[::2], cycle[1::2]):
        if j1 < j2:
            chromosome.append(j2 // 2)
        else:
            chromosome.append(-j1 // 2)
    return chromosome

sample_input: str = "(1 2 4 3 6 5 7 8)"

cycle_string: str = sample_input.strip()
chromosome: List[int] = cycle_to_chromosome(parse_cycle(cycle_string))
print(format_chromosome(chromosome))

69 Implement ColoredEdges

Colored Edges Problem. Find the Colored Edges in a genome.

Given: A genome P.

Return: The collection of colored edges in the genome graph of P in the form (xy).

69.1 Sample Dataset

(+1 -2 -3)(+4 +5 -6)

69.2 Sample Output

(2, 4), (3, 6), (5, 1), (8, 9), (10, 12), (11, 7)

69.3 Solution

import re
from typing import List, Dict, Tuple

def chromosome_to_cycle(chromosome: List[int]) -> List[int]:
    nodes: List[int] = []
    for gene in chromosome:
        if gene > 0:
            nodes.extend([2 * gene - 1, 2 * gene])
        else:
            nodes.extend([-2 * gene, -2 * gene - 1])
    return nodes

def parse_integers(string: str) -> List[int]:
    return list(map(int, string.split()))

def get_colored_edges(genome: List[List[int]]) -> Dict[int, int]:
    edge_dict: Dict[int, int] = {}
    for chromosome in genome:
        nodes = chromosome_to_cycle(chromosome)
        for j in range(len(chromosome)):
            start_index = 2 * j + 1
            end_index = (2 * j + 2) % len(nodes)
            edge_dict[nodes[start_index]] = nodes[end_index]
    return edge_dict

sample_input: str = "(+1 -2 -3)(+4 +5 -6)"

genome_string: str = sample_input.strip()
genome: List[List[int]] = [parse_integers(x) for x in re.findall(r"\((.+?)\)", genome_string)]
edges: List[Tuple[int, int]] = [(k, v) for k, v in get_colored_edges(genome).items()]
print(*edges, sep=", ")

70 Implement GraphToGenome

Graph To Genome Problem. Solve the Graph To Genome Problem.

Given: The colored edges of a genome graph.

Return: A genome corresponding to the genome graph.

70.1 Sample Dataset

(2, 4), (3, 6), (5, 1), (7, 9), (10, 12), (11, 8)

70.2 Sample Output

(+1 -2 -3)(-4 +5 -6)

70.3 Solution

import re
from typing import List, Dict, Tuple, Iterator
from copy import copy

def format_chromosome(chromosome: List[int]) -> str:
    return "(" + " ".join([f"{gene:+}" for gene in chromosome]) + ")"

def cycle_to_chromosome(cycle: List[int]) -> List[int]:
    chromosome: List[int] = []
    for j1, j2 in zip(cycle[::2], cycle[1::2]):
        if j1 < j2:
            chromosome.append(j2 // 2)
        else:
            chromosome.append(-j1 // 2)
    return chromosome

def parse_integers(string: str) -> List[int]:
    return list(map(int, string.split(", ")))

def get_first_key(dictionary: Dict) -> int:
    return next(iter(dictionary.keys()))

# Find a single cycle from colored edges
def find_node_cycle(graph: Dict[int, int]) -> List[int]:
    start: int = get_first_key(graph)
    current: int = start
    component: List[int] = []
    while graph:
        next_node: int = graph.pop(current)
        graph.pop(next_node)
        neighbor: int = next_node + 1 if next_node % 2 else next_node - 1
        if neighbor == start:
            return [next_node] + component + [current]
        component.extend([current, next_node])
        current = neighbor

# find cycles in colored edges
# to do this, we first make each edge "undirected"
def find_node_cycles(graph: Dict[int, int]) -> Iterator[List[int]]:
    graph = copy(graph)
    for k, v in list(graph.items()):
        graph[v] = k
    while graph:
        yield find_node_cycle(graph)

def graph_to_genome(genome_graph: Dict[int, int]) -> List[List[int]]:
    genome: List[List[int]] = []
    for nodes in find_node_cycles(genome_graph):
        genome.append(cycle_to_chromosome(nodes))
    return genome

def parse_edge_string(edge_string: str) -> Dict[int, int]:
    graph: Dict[int, int] = {}
    for x in re.findall(r"\((.+?)\)", edge_string):
        a, b = parse_integers(x)
        graph[a] = b
    return graph

sample_input: str = "(2, 4), (3, 6), (5, 1), (7, 9), (10, 12), (11, 8)"

edge_string: str = sample_input.strip()
genome_graph: Dict[int, int] = parse_edge_string(edge_string)
print(*[format_chromosome(x) for x in graph_to_genome(genome_graph)], sep="")

71 Implement 2-BreakOnGenomeGraph

2-Break On Genome Graph Problem. Solve the 2-Break On Genome Graph Problem.

Given: The colored edges of a genome graph GenomeGraph, followed by indices ii’j, and j’.

Return: The colored edges of the genome graph resulting from applying the 2-break operation.

71.1 Sample Dataset

(2, 4), (3, 8), (7, 5), (6, 1)
1, 6, 3, 8

71.2 Sample Output

(2, 4), (3, 1), (7, 5), (6, 8)

71.3 Solution

import re
from typing import Dict, List, Tuple
from copy import copy

def parse_edge_string(edge_string: str) -> Dict[int, int]:
    graph: Dict[int, int] = {}
    for match in re.findall(r"\((.+?)\)", edge_string):
        node1, node2 = parse_integers(match)
        graph[node1] = node2
    return graph

def parse_integers(string: str) -> List[int]:
    return list(map(int, string.split(", ")))

def remove_edge(graph: Dict[int, int], edge: Tuple[int, int]) -> None:
    if edge[0] in graph:
        graph.pop(edge[0])
    else:
        graph.pop(edge[1])

def two_break_on_genome_graph(graph: Dict[int, int], i: int, ip: int, j: int, jp: int) -> Dict[int, int]:
    new_graph: Dict[int, int] = copy(graph)
    for edge in [(i, ip), (j, jp)]:
        remove_edge(new_graph, edge)
    new_graph[i] = j
    new_graph[ip] = jp
    return new_graph

sample_input: str = """
(2, 4), (3, 8), (7, 5), (6, 1)
1, 6, 3, 8
"""

edge_string, break_points = sample_input.strip().split("\n")
graph: Dict[int, int] = parse_edge_string(edge_string)
break_points_list: List[int] = parse_integers(break_points)
new_graph: Dict[int, int] = two_break_on_genome_graph(graph, *break_points_list)
edges: List[Tuple[int, int]] = [(k, v) for k, v in new_graph.items()]
print(*edges, sep=", ")

72 Implement 2-BreakOnGenome

Implement 2-BreakOnGenome. Solve the 2-Break On Genome Graph Problem.

Given: A genome P, followed by indices ii’j, and j’.

Return: The genome P’ resulting from applying the 2-break operation.

72.1 Sample Dataset

(+1 -2 -4 +3)
1, 6, 3, 8

72.2 Sample Output

(+1 -2) (-4 +3)

72.3 Solution

from typing import List, Dict, Tuple, Iterator
from copy import copy

def parse_permutation(s: str) -> List[int]:
    return list(map(int, s[1:-1].split()))

def format_permutation(chromosome: List[int]) -> str:
    return "(" + " ".join([f"{gene:+}" for gene in chromosome]) + ")"

def chromosome_to_cycle(chromosome: List[int]) -> List[int]:
    nodes: List[int] = []
    for gene in chromosome:
        if gene > 0:
            nodes.extend([2 * gene - 1, 2 * gene])
        else:
            nodes.extend([-2 * gene, -2 * gene - 1])
    return nodes
    
def colored_edges(genome: List[List[int]]) -> Dict[int, int]:
    graph: Dict[int, int] = {}
    for chromosome in genome:
        nodes = chromosome_to_cycle(chromosome)
        for j in range(len(chromosome)):
            start_index = 2 * j + 1
            end_index = (2 * j + 2) % len(nodes)
            graph[nodes[start_index]] = nodes[end_index]
    return graph

def remove_edge(graph: Dict[int, int], edge: Tuple[int, int]) -> None:
    if edge[0] in graph:
        graph.pop(edge[0])
    else:
        graph.pop(edge[1])
        
def two_break_on_genome_graph(graph: Dict[int, int], i: int, ip: int, j: int, jp: int) -> Dict[int, int]:
    new_graph = copy(graph)
    for edge in [(i, ip), (j, jp)]:
        remove_edge(new_graph, edge)
    new_graph[i] = j
    new_graph[ip] = jp
    return new_graph

def get_first_key(dictionary: Dict) -> int:
    return next(iter(dictionary.keys()))
    
def find_node_cycle(graph: Dict[int, int]) -> List[int]:
    start = get_first_key(graph)
    current = start
    component: List[int] = []
    while graph:
        next_node = graph.pop(current)
        graph.pop(next_node)
        neighbor = next_node + 1 if next_node % 2 else next_node - 1
        if neighbor == start:
            return [next_node] + component + [current]
        component.extend([current, next_node])
        current = neighbor
        
def find_node_cycles(graph: Dict[int, int]) -> Iterator[List[int]]:
    graph = copy(graph)
    for k, v in list(graph.items()):
        graph[v] = k
    while graph:
        yield find_node_cycle(graph)

def cycle_to_chromosome(cycle: List[int]) -> List[int]:
    chromosome: List[int] = []
    for j1, j2 in zip(cycle[::2], cycle[1::2]):
        if j1 < j2:
            chromosome.append(j2 // 2)
        else:
            chromosome.append(-j1 // 2)
    return chromosome

def graph_to_genome(genome_graph: Dict[int, int]) -> List[List[int]]:
    genome: List[List[int]] = []
    for nodes in find_node_cycles(genome_graph):
        genome.append(cycle_to_chromosome(nodes))
    return genome

def parse_integers(x: str) -> List[int]:
    return list(map(int, x.split(", ")))

def two_break_on_genome(chromosome: List[int], i: int, ip: int, j: int, jp: int) -> List[List[int]]:
    genome_graph = colored_edges([chromosome])
    genome_graph = two_break_on_genome_graph(genome_graph, i, ip, j, jp)
    return graph_to_genome(genome_graph)

sample_input: str = """
(+1 -2 -4 +3)
1, 6, 3, 8
"""

genome_str, indices_str = sample_input.strip().split("\n")
genome = parse_permutation(genome_str)
new_genome = two_break_on_genome(genome, *parse_integers(indices_str))
print(*[format_permutation(x) for x in new_genome])

73 Compute Distances Between Leaves

Distance Between Leaves Problem. Compute the distances between leaves in a weighted tree.

Given: An integer n followed by the adjacency list of a weighted tree with n leaves.

Return: A space-separated n x n (*d__ij), where d__ij is the length of the path between leaves i and j*.

73.1 Sample Dataset

4
0->4:11
1->4:2
2->5:6
3->5:7
4->0:11
4->1:2
4->5:4
5->4:4
5->3:7
5->2:6

73.2 Sample Output

0   13  21  22
13  0   12  13
21  12  0   13
22  13  13  0

73.3 Solution

from re import split
from collections import defaultdict
from math import inf
from heapq import heappush, heappop
from typing import Dict, List, Set, Tuple

def get_all_nodes(graph: Dict[int, List[Dict[str, int]]]) -> Set[int]:
    source_nodes = set(graph.keys())
    destination_nodes = {edge["n"] for edges in graph.values() for edge in edges}
    return source_nodes | destination_nodes

# Dijkstra's algorithm to find distance from start to all other nodes
# Assumes nodes are integers starting at 0!
def dijkstra(start: int, graph: Dict[int, List[Dict[str, int]]]) -> List[float]:
    distances = [inf for _ in range(len(get_all_nodes(graph)))]
    distances[start] = 0
    priority_queue: List[Tuple[float, int]] = []
    heappush(priority_queue, (0, start))
    processed_nodes: Set[int] = set()

    while priority_queue:
        current_node = heappop(priority_queue)[1]
        processed_nodes.add(current_node)
        for neighbor in graph[current_node]:
            if neighbor["n"] not in processed_nodes:
                distances[neighbor["n"]] = min(distances[current_node] + neighbor["w"], distances[neighbor["n"]])
                heappush(priority_queue, (distances[neighbor["n"]], neighbor["n"]))

    return distances

def parse_weighted_graph(edges: List[str]) -> Dict[int, List[Dict[str, int]]]:
    graph: Dict[int, List[Dict[str, int]]] = defaultdict(list)

    for edge in edges:
        from_node, to_node, weight = map(int, split(r"\D+", edge))
        graph[from_node].append({"n": to_node, "w": weight})

    return graph

sample_input = """
4
0->4:11
1->4:2
2->5:6
3->5:7
4->0:11
4->1:2
4->5:4
5->4:4
5->3:7
5->2:6
"""

num_leaves, *edges = sample_input.strip().split("\n")
num_leaves = int(num_leaves)
graph = parse_weighted_graph(edges)
for i in range(num_leaves):
    print(*dijkstra(i, graph)[:num_leaves])

74 Compute Limb Lengths in a Tree

Limb Length Problem. Find the limb length for a leaf in a tree.

Given: An integer n, followed by an integer j between 0 and n - 1, followed by a space-separated additive distance matrix D (whose elements are integers).

Return: The limb length of the leaf in Tree(D) corresponding to row j of this distance matrix (use 0-based indexing).

74.1 Sample Dataset

4
1
0   13  21  22
13  0   12  13
21  12  0   13
22  13  13  0

74.2 Sample Output

2

74.3 Solution

from re import split
from collections import defaultdict
from math import inf
from heapq import heappush, heappop
from typing import Dict, List, Set, Tuple

def get_all_nodes(graph: Dict[int, List[Dict[str, int]]]) -> Set[int]:
    source_nodes: Set[int] = set(graph.keys())
    destination_nodes: Set[int] = {edge["to"] for edges in graph.values() for edge in edges}
    return source_nodes | destination_nodes

# Dijkstra's algorithm to find distance from start to all other nodes
# Assumes nodes are integers starting at 0!
def dijkstra(start: int, graph: Dict[int, List[Dict[str, int]]]) -> List[float]:
    distances: List[float] = [inf for _ in range(len(get_all_nodes(graph)))]
    distances[start] = 0
    priority_queue: List[Tuple[float, int]] = []
    heappush(priority_queue, (0, start))
    processed_nodes: Set[int] = set()

    while priority_queue:
        current_distance, current_node = heappop(priority_queue)
        if current_node in processed_nodes:
            continue
        processed_nodes.add(current_node)
        for neighbor in graph[current_node]:
            neighbor_node: int = neighbor["to"]
            edge_weight: int = neighbor["weight"]
            if neighbor_node not in processed_nodes:
                new_distance: float = current_distance + edge_weight
                if new_distance < distances[neighbor_node]:
                    distances[neighbor_node] = new_distance
                    heappush(priority_queue, (new_distance, neighbor_node))

    return distances

def parse_weighted_graph(edges: List[str]) -> Dict[int, List[Dict[str, int]]]:
    graph: Dict[int, List[Dict[str, int]]] = defaultdict(list)

    for edge in edges:
        from_node, to_node, weight = map(int, split(r"\D+", edge))
        graph[from_node].append({"to": to_node, "weight": weight})

    return graph

sample_input: str = """
4
0->4:11
1->4:2
2->5:6
3->5:7
4->0:11
4->1:2
4->5:4
5->4:4
5->3:7
5->2:6
"""

num_leaves, *edges = sample_input.strip().split("\n")
num_leaves: int = int(num_leaves)
graph: Dict[int, List[Dict[str, int]]] = parse_weighted_graph(edges)
for i in range(num_leaves):
    print(*dijkstra(i, graph)[:num_leaves])

75 Implement AdditivePhylogeny

Additive Phylogeny Problem. Construct the simple tree fitting an additive matrix.

Given: n and a tab-delimited n x n additive matrix.

Return: A weighted adjacency list for the simple tree fitting this matrix.

Note on formatting: The adjacency list must have consecutive integer node labels starting from 0. The n leaves must be labeled 0, 1, …, n-1 in order of their appearance in the distance matrix. Labels for internal nodes may be labeled in any order but must start from n and increase consecutively.

75.1 Sample Dataset

4
0   13  21  22
13  0   12  13
21  12  0   13
22  13  13  0

75.2 Sample Output

0->4:11
1->4:2
2->5:6
3->5:7
4->0:11
4->1:2
4->5:4
5->2:6
5->3:7
5->4:4

75.3 Solution

from collections import defaultdict
from typing import List, Dict, Set, Tuple, Generator

# Type aliases for clarity
DistanceMatrix = List[List[int]]
Graph = Dict[int, List[Dict[str, int]]]

def parse_distance_matrix(lines: List[str]) -> DistanceMatrix:
    """Parse integer matrix from set of lines"""
    return [[int(x) for x in line.split()] for line in lines]

def calculate_limb_length(distance_matrix: DistanceMatrix, j: int) -> int:
    """Calculate limb length j for distance matrix"""
    min_limb_length = float('inf')
    n = len(distance_matrix)
    for k in range(n):
        for i in range(n):
            if j != k and i != j:
                limb_length = (distance_matrix[i][j] + distance_matrix[j][k] - distance_matrix[i][k]) // 2
                min_limb_length = min(limb_length, min_limb_length)
    return min_limb_length

def get_all_nodes(graph: Graph) -> Set[int]:
    """Get all nodes in the graph"""
    source_nodes = set(graph.keys())
    target_nodes = {edge["n"] for edges in graph.values() for edge in edges}
    return source_nodes | target_nodes

def find_path(graph: Graph, path: List[Tuple[int, int]], target: int) -> Generator[List[Tuple[int, int]], None, None]:
    """Search tree, returning route to target and cumulative distance"""
    if target in [x[0] for x in path]:
        yield path
    current_node, current_distance = path[-1]
    if current_node in graph:
        for edge in graph[current_node]:
            if edge["n"] not in [x[0] for x in path]:
                new_path = path + [(edge["n"], current_distance + edge["w"])]
                yield from find_path(graph, new_path, target)

def find_leaves(distance_matrix: DistanceMatrix, n: int) -> Tuple[int, int, int]:
    """Find three leaves i, n, k such that D[i][k] = D[i][n] + D[n][k]"""
    for i in range(len(distance_matrix)):
        for k in range(i + 1, len(distance_matrix)):
            if distance_matrix[i][k] == distance_matrix[i][n] + distance_matrix[n][k]:
                return i, n, k
    raise ValueError("No suitable leaves found")

def add_node(tree: Graph, i: int, k: int, x: int, n: int) -> Graph:
    """Add node in graph between i and k, distance x from i, labelled n"""
    path = list(find_path(tree, [(i, 0)], k))[0]
    for p, node in enumerate(path):
        if node[1] > x:
            break
    p = p - 1
    i, d1 = path[p]
    k, d2 = path[p + 1]

    # Delete old edge and add new edges
    tree[i] = [edge for edge in tree[i] if edge["n"] != k]
    tree[i].append({"n": n, "w": x - d1})
    tree.setdefault(n, []).append({"n": k, "w": d2 - x})
    return tree

def additive_phylogeny(distance_matrix: DistanceMatrix, m: int) -> Graph:
    n = len(distance_matrix) - 1
    if len(distance_matrix) == 2:
        graph = defaultdict(list)
        graph[0].append({"n": 1, "w": distance_matrix[0][1]})
        return graph

    limb_length = calculate_limb_length(distance_matrix, n)
    for j in range(len(distance_matrix)):
        if j != n:
            distance_matrix[j][n] -= limb_length
            distance_matrix[n][j] = distance_matrix[j][n]

    i, n, k = find_leaves(distance_matrix, n)
    x = distance_matrix[i][n]

    # Remove row n and column n from distance_matrix
    reduced_matrix = [row[:n] + row[n+1:] for row in distance_matrix[:n] + distance_matrix[n+1:]]

    tree = additive_phylogeny(reduced_matrix, m)

    # Label for new internal node
    v = max(max(get_all_nodes(tree)), m - 1) + 1

    # Break an internal edge adding a new node (possibly) and add the new leaf node
    tree = add_node(tree, i, k, x, v)
    tree.setdefault(v, []).append({"n": n, "w": limb_length})
    return tree

def get_edges(graph: Graph) -> List[str]:
    edges = []
    for k in sorted(graph):
        for v in graph[k]:
            edges.append(f"{k}->{v['n']}:{v['w']}")
            edges.append(f"{v['n']}->{k}:{v['w']}")
    return sorted(edges)

# Sample usage
sample_input = """
4
0   13  21  22
13  0   12  13
21  12  0   13
22  13  13  0
"""

n, *distance_matrix_str = sample_input.strip().split("\n")
distance_matrix = parse_distance_matrix(distance_matrix_str)
graph = additive_phylogeny(distance_matrix, int(n))
for edge in get_edges(graph):
    print(edge)

76 Implement UPGMA

UPGMA Problem. Construct the ultrametric tree resulting from UPGMA.

Given: An integer n followed by a space-delimited n x n distance matrix.

Return: An adjacency list for the ultrametric tree output by UPGMA. Weights should be accurate to three decimal places.

Note on formatting: The adjacency list must have consecutive integer node labels starting from 0. The n leaves must be labeled 0, 1, …, n-1 in order of their appearance in the distance matrix. Labels for internal nodes may be labeled in any order but must start from n and increase consecutively.

76.1 Sample Dataset

4
0   20  17  11
20  0   20  13
17  20  0   10
11  13  10  0

76.2 Sample Output

0->5:7.000
1->6:8.833
2->4:5.000
3->4:5.000
4->2:5.000
4->3:5.000
4->5:2.000
5->0:7.000
5->4:2.000
5->6:1.833
6->5:1.833
6->1:8.833

76.3 Solution

from typing import List

def parse_matrix(lines: List[str]) -> List[List[int]]:
    """Parse integer matrix from set of lines"""
    return [[int(x) for x in line.split()] for line in lines]

import numpy as np
from collections import defaultdict
from typing import Dict, List, Tuple

def as_edges(graph: Dict[int, List[Dict[str, float]]]) -> List[str]:
    edges = []
    for source in sorted(graph):
        for target in graph[source]:
            edges.append(f"{source}->{target['n']}:{target['w']:f}")
            edges.append(f"{target['n']}->{source}:{target['w']:f}")
    return sorted(edges)

def closest(distance_matrix: np.ndarray) -> Tuple[int, int]:
    """Find (first) minimum off diagonal index in an array"""
    distance_matrix = np.copy(distance_matrix)
    np.fill_diagonal(distance_matrix, distance_matrix.max() + 1)
    return divmod(distance_matrix.argmin(), distance_matrix.shape[1])

def average_ind(distance_matrix: np.ndarray, i: int, j: int, size_i: int, size_j: int) -> np.ndarray:
    """Replace the ith row/col with the average of the ith and jth and remove the jth"""
    distance_matrix = np.copy(distance_matrix)
    average = (distance_matrix[i, :] * size_i + distance_matrix[j, :] * size_j) / (size_i + size_j)
    distance_matrix[i, :] = average
    distance_matrix[:, i] = average
    distance_matrix = np.delete(distance_matrix, j, 0)
    distance_matrix = np.delete(distance_matrix, j, 1)
    np.fill_diagonal(distance_matrix, 0)
    return distance_matrix

def upgma(distance_matrix: np.ndarray, num_clusters: int) -> Dict[int, List[Dict[str, float]]]:
    clusters = list(range(0, num_clusters))
    ages: Dict[int, float] = defaultdict(lambda: 0)  # the "age" of a node
    size: Dict[int, int] = defaultdict(lambda: 1)  # the number of descendants of a node
    tree: Dict[int, List[Dict[str, float]]] = {}  # the graph / tree we're building
    node_label = num_clusters  # a label for internal nodes as we add them
    
    while len(clusters) > 1:
        i, j = closest(distance_matrix)
        a, b = clusters[i], clusters[j]

        tree[node_label] = [
            {"n": a, "w": distance_matrix[i, j] / 2 - ages[a]},
            {"n": b, "w": distance_matrix[i, j] / 2 - ages[b]},
        ]
        size[node_label] = size[a] + size[b]
        ages[node_label] = distance_matrix[i, j] / 2
        clusters[i] = node_label
        del clusters[j]
        distance_matrix = average_ind(distance_matrix, *closest(distance_matrix), size[a], size[b])
        node_label += 1

    return tree

sample_input = """
4
0   20  17  11
20  0   20  13
17  20  0   10
11  13  10  0
"""

num_clusters, *distance_data = sample_input.strip().split("\n")
distance_matrix = np.array(parse_matrix(distance_data), float)
graph = upgma(distance_matrix, int(num_clusters))
for edge in as_edges(graph):
    print(edge)

77 Implement the Neighbor Joining Algorithm

Neighbor Joining Problem. Construct the tree resulting from applying the neighbor-joining algorithm to a distance matrix.

Given: An integer n, followed by a space-separated n x n distance matrix.

Return: An adjacency list for the tree resulting from applying the neighbor-joining algorithm. Edge-weights should be accurate to two decimal places (they are provided to three decimal places in the sample output below).

Note on formatting: The adjacency list must have consecutive integer node labels starting from 0. The n leaves must be labeled 0, 1, …, n-1 in order of their appearance in the distance matrix. Labels for internal nodes may be labeled in any order but must start from n and increase consecutively.

77.1 Sample Dataset

4
0   23  27  20
23  0   30  28
27  30  0   30
20  28  30  0

77.2 Sample Output

0->4:8.000
1->5:13.500
2->5:16.500
3->4:12.000
4->5:2.000
4->0:8.000
4->3:12.000
5->1:13.500
5->2:16.500
5->4:2.000

77.3 Solution

from collections import defaultdict
from typing import List, Dict, Union
import numpy as np

def parse_matrix(lines: List[str]) -> List[List[int]]:
    """Parse integer matrix from set of lines"""
    return [[int(x) for x in line.split()] for line in lines]

def format_edges(tree: Dict[int, List[Dict[str, Union[int, float]]]]) -> List[str]:
    formatted_edges = []
    for node in sorted(tree):
        for neighbor in tree[node]:
            formatted_edges.append(f"{node}->{neighbor['node']}:{neighbor['weight']:f}")
            formatted_edges.append(f"{neighbor['node']}->{node}:{neighbor['weight']:f}")
    return sorted(formatted_edges)

def find_closest_pair(distance_matrix: np.ndarray) -> tuple[int, int]:
    """Find (first) minimum off-diagonal index in an array"""
    temp_matrix = np.copy(distance_matrix)
    np.fill_diagonal(temp_matrix, temp_matrix.max() + 1)
    return divmod(temp_matrix.argmin(), temp_matrix.shape[1])

def calculate_neighbor_joining_matrix(distance_matrix: np.ndarray, num_nodes: int) -> np.ndarray:
    nj_matrix = np.copy(distance_matrix)
    for i in range(len(distance_matrix)):
        for j in range(len(distance_matrix)):
            if i != j:
                nj_matrix[i, j] = (num_nodes - 2) * distance_matrix[i, j] - sum(distance_matrix[i, :]) - sum(distance_matrix[j, :])
    return nj_matrix

def neighbor_joining(distance_matrix: np.ndarray, num_nodes: int, labels: List[int] = None) -> Dict[int, List[Dict[str, Union[int, float]]]]:
    if not labels:
        labels = list(range(num_nodes))

    if num_nodes == 2:
        tree = defaultdict(list)
        tree[labels[0]].append({"node": labels[1], "weight": distance_matrix[0][1]})
        return tree

    nj_matrix = calculate_neighbor_joining_matrix(distance_matrix, num_nodes)
    i, j = find_closest_pair(nj_matrix)
    delta = (sum(distance_matrix[i, :]) - sum(distance_matrix[j, :])) / (num_nodes - 2)
    limb_i = (distance_matrix[i, j] + delta) / 2
    limb_j = (distance_matrix[i, j] - delta) / 2

    label_i = labels[i]
    label_j = labels[j]

    distance_matrix = np.append(distance_matrix, np.zeros((1, len(distance_matrix))), axis=0)
    distance_matrix = np.append(distance_matrix, np.zeros((len(distance_matrix), 1)), axis=1)
    labels = labels + [max(labels) + 1]

    for k in range(num_nodes):
        distance_matrix[k, num_nodes] = (distance_matrix[k, i] + distance_matrix[k, j] - distance_matrix[i, j]) / 2
        distance_matrix[num_nodes, k] = (distance_matrix[k, i] + distance_matrix[k, j] - distance_matrix[i, j]) / 2
    for x in [j, i]:
        distance_matrix = np.delete(distance_matrix, x, 0)
        distance_matrix = np.delete(distance_matrix, x, 1)
        del labels[x]

    tree = neighbor_joining(distance_matrix, num_nodes - 1, labels)

    tree[labels[-1]].append({"node": label_i, "weight": limb_i})
    tree[labels[-1]].append({"node": label_j, "weight": limb_j})
    return tree

sample_input = """
4
0   23  27  20
23  0   30  28
27  30  0   30
20  28  30  0
"""

num_nodes, *distance_matrix = sample_input.strip().split("\n")
distance_matrix = np.array(parse_matrix(distance_matrix), float)
tree = neighbor_joining(distance_matrix, int(num_nodes))
for edge in format_edges(tree):
    print(edge)

78 Implement SmallParsimony

Small Parsimony Problem. Find the most parsimonious labeling of the internal nodes of a rooted tree.

Given: An integer n followed by an adjacency list for a rooted binary tree with n leaves labeled by DNA strings.

Return: The minimum parsimony score of this tree, followed by the adjacency list of the tree corresponding to labeling internal nodes by DNA strings in order to minimize the parsimony score of the tree.

Note: Remember to run SmallParsimony on each individual index of the strings at the leaves of the tree.

78.1 Sample Dataset

4
4->CAAATCCC
4->ATTGCGAC
5->CTGCGCTG
5->ATGGACGA
6->4
6->5

78.2 Sample Output

16
ATAGACAA->ATAGACAC:1
ATAGACAC->ATAGACAA:1
ATAGACAC->CAAATCCC:5
CAAATCCC->ATAGACAC:5
ATAGACAC->ATTGCGAC:3
ATTGCGAC->ATAGACAC:3
ATAGACAA->ATGGACAA:1
ATGGACAA->ATAGACAA:1
ATGGACAA->CTGCGCTG:5
CTGCGCTG->ATGGACAA:5
ATGGACAA->ATGGACGA:1
ATGGACGA->ATGGACAA:1

78.3 Solution

79 Adapt SmallParsimony to Unrooted Trees

Small Parsimony in an Unrooted Tree Problem. Find the most parsimonious labeling of the internal nodes in an unrooted tree.

Given: An unrooted binary tree with each leaf labeled by a string of length m.

Return: A labeling of all other nodes of the tree by strings of length m that minimizes the parsimony score of the tree.

Note on formatting: Your internal node labelings may differ from the sample provided.

79.1 Sample Dataset

4
TCGGCCAA->4
4->TCGGCCAA
CCTGGCTG->4
4->CCTGGCTG
CACAGGAT->5
5->CACAGGAT
TGAGTACC->5
5->TGAGTACC
4->5
5->4

79.2 Sample Output

17
TCGGCCAA->CCAGGCAC:4
CCTGGCTG->CCAGGCAC:3
TGAGTACC->CAAGGAAC:4
CCAGGCAC->CCTGGCTG:3
CCAGGCAC->CAAGGAAC:2
CCAGGCAC->TCGGCCAA:4
CACAGGAT->CAAGGAAC:4
CAAGGAAC->CACAGGAT:4
CAAGGAAC->TGAGTACC:4
CAAGGAAC->CCAGGCAC:2

79.3 Solution

from collections import defaultdict
from math import inf
from typing import Dict, List, Set, Tuple

# return all nodes of a simple graph
def nodes(graph: Dict[int, List[int]]) -> Set[int]:
    s = list(graph.keys())
    e = [y for v in graph.values() for y in v]
    return set(s) | set(e)

# return all leaves of a simple graph
def leaves(graph: Dict[int, List[int]]) -> Set[int]:
    return set(y for v in list(graph.values()) for y in v if not graph[y])

# return all root node of a simple graph
def root(graph: Dict[int, List[int]]) -> int:
    rev = reverse_graph(graph)
    node = list(nodes(graph))[0]
    while node in rev:
        node = rev[node]
    return node

# reverse a simple graph (child points to parent)
def reverse_graph(graph: Dict[int, List[int]]) -> Dict[int, int]:
    rev: Dict[int, int] = {}
    for node in graph:
        for child in graph[node]:
            rev[child] = node
    return rev

def parse_input(input_string: str) -> Tuple[Dict[int, str], Dict[int, List[int]]]:
    lines = input_string.strip().split('\n')
    n = int(lines[0])
    seqs: Dict[int, str] = {}
    graph: Dict[int, List[int]] = defaultdict(list)
    for i, edge in enumerate(lines[1:n+1]):
        f, t = edge.rstrip().split("->")
        graph[int(f)].append(i)
        seqs[i] = t
    for edge in lines[n+1:]:
        f, t = edge.rstrip().split("->")
        graph[int(f)].append(int(t))
    return seqs, graph

# print (bidirectional) edges
def print_edges(graph: Dict[int, List[int]], seqs: Dict[int, str], node: int) -> None:
    for child in graph[node]:
        if node in seqs and child in seqs:
            dist = sum(a != b for a, b in zip(seqs[node], seqs[child]))
            print(f"{seqs[node]}->{seqs[child]}:{dist}")
            print(f"{seqs[child]}->{seqs[node]}:{dist}")
        print_edges(graph, seqs, child)

def extract_position(graph: Dict[int, List[int]], seqs: Dict[int, str], pos: int) -> Dict[int, str]:
    chars: Dict[int, str] = {}
    for n in nodes(graph) - leaves(graph):
        chars[n] = ""
    for leaf in leaves(graph):
        chars[leaf] = seqs[leaf][pos]
    return chars

def traceback(skp: Dict[int, List[Dict[int, int]]], node: int, ind: int) -> Dict[int, str]:
    bases = ["A", "C", "T", "G"]
    chars: Dict[int, str] = {}
    chars[node] = bases[ind]
    for k, v in skp[node][ind].items():
        if k in skp:
            chars = chars | traceback(skp, k, v)
    return chars

def small_parsimony(graph: Dict[int, List[int]], chars: Dict[int, str]) -> Tuple[int, Dict[int, str]]:
    bases = ["A", "C", "T", "G"]
    sk: Dict[int, List[int]] = {}  # minimum parsimony score of the subtree over possible labels
    skp: Dict[int, List[Dict[int, int]]] = {}  # pointer to selected base for each child over possible labels
    to_process = nodes(graph)

    # initialise leaves
    for leaf in leaves(graph):
        sk[leaf] = [0 if chars[leaf] == c else inf for c in bases]
        to_process.remove(leaf)

    # iterate over available nodes till all are processed
    while to_process:
        for n in list(to_process):
            if all(v in sk for v in graph[n]):
                sk[n], skp[n] = [], []
                for k in bases:
                    tot = 0
                    ptr: Dict[int, int] = {}
                    for d, sk_child in [(d, sk[d]) for d in graph[n]]:
                        score = []
                        for i, c in enumerate(bases):
                            score += [sk_child[i] + (0 if c == k else 1)]
                        tot += min(score)
                        ptr[d] = score.index(min(score))
                    skp[n] += [ptr]
                    sk[n] += [tot]
                to_process.remove(n)

    # Recover sequence
    node = root(graph)
    score = min(sk[node])
    return score, traceback(skp, node, sk[node].index(score))

def ba6f(graph: Dict[int, List[int]], seqs: Dict[int, str]) -> Tuple[int, Dict[int, str]]:
    # initialise sequences
    for n in nodes(graph) - leaves(graph):
        seqs[n] = ""

    total_score = 0
    for pos in range(len(next(iter(seqs.values())))):
        chars = extract_position(graph, seqs, pos)
        score, tbchars = small_parsimony(graph, chars)
        total_score += score
        for k, v in tbchars.items():
            seqs[k] += v

    return total_score, seqs

sample_input = """
4
4->CAAATCCC
4->ATTGCGAC
5->CTGCGCTG
5->ATGGACGA
6->4
6->5
"""

seqs, graph = parse_input(sample_input)
total_score, seqs = ba6f(graph, seqs)
print(total_score)
print_edges(graph, seqs, root(graph))

80 Adapt SmallParsimony to Unrooted Trees

Small Parsimony in an Unrooted Tree Problem. Find the most parsimonious labeling of the internal nodes in an unrooted tree.

Given: An unrooted binary tree with each leaf labeled by a string of length m.

Return: A labeling of all other nodes of the tree by strings of length m that minimizes the parsimony score of the tree.

Note on formatting: Your internal node labelings may differ from the sample provided.

80.1 Sample Dataset

4
TCGGCCAA->4
4->TCGGCCAA
CCTGGCTG->4
4->CCTGGCTG
CACAGGAT->5
5->CACAGGAT
TGAGTACC->5
5->TGAGTACC
4->5
5->4

80.2 Sample Output

17
TCGGCCAA->CCAGGCAC:4
CCTGGCTG->CCAGGCAC:3
TGAGTACC->CAAGGAAC:4
CCAGGCAC->CCTGGCTG:3
CCAGGCAC->CAAGGAAC:2
CCAGGCAC->TCGGCCAA:4
CACAGGAT->CAAGGAAC:4
CAAGGAAC->CACAGGAT:4
CAAGGAAC->TGAGTACC:4
CAAGGAAC->CCAGGCAC:2

80.3 Solution

from collections import defaultdict
from typing import Dict, List, Set, Tuple, TextIO
import io
from math import inf

def nodes(graph: Dict[int, List[int]]) -> Set[int]:
    s = list(graph.keys())
    e = [y for v in graph.values() for y in v]
    return set(s) | set(e)

def leaves(graph: Dict[int, List[int]]) -> Set[int]:
    return set(y for v in list(graph.values()) for y in v if not graph[y])

def root(graph: Dict[int, List[int]]) -> int:
    rev = reverse_graph(graph)
    node = list(nodes(graph))[0]
    while node in rev:
        node = rev[node]
    return node

def get_all_nodes(graph: Dict[int, List[int]]) -> Set[int]:
    source_nodes = set(graph.keys())
    target_nodes = {target for targets in graph.values() for target in targets}
    return source_nodes | target_nodes

def reverse_graph(graph: Dict[int, List[int]]) -> Dict[int, int]:
    reversed_graph: Dict[int, int] = {}
    for parent, children in graph.items():
        for child in children:
            reversed_graph[child] = parent
    return reversed_graph

def get_leaves(graph: Dict[int, List[int]]) -> Set[int]:
    return {child for children in graph.values() for child in children if not graph[child]}

def find_root(graph: Dict[int, List[int]]) -> int:
    reversed_graph = reverse_graph(graph)
    node = next(iter(get_all_nodes(graph)))
    while node in reversed_graph:
        node = reversed_graph[node]
    return node

def print_edges(graph: Dict[int, List[int]], sequences: Dict[int, str], node: int) -> None:
    for child in graph[node]:
        distance = sum(a != b for a, b in zip(sequences[node], sequences[child]))
        print(f"{sequences[node]}->{sequences[child]}:{distance}")
        print(f"{sequences[child]}->{sequences[node]}:{distance}")
        print_edges(graph, sequences, child)

def root_tree(graph: Dict[int, List[int]], node: int) -> None:
    for child in graph[node]:
        if node in graph[child]:
            graph[child].remove(node)
        root_tree(graph, child)

def parse_input(handle: TextIO) -> Tuple[Dict[int, str], Dict[int, List[int]]]:
    n = int(next(handle))
    sequences: Dict[int, str] = {}
    graph: Dict[int, List[int]] = defaultdict(list)
    for i in range(n):
        next(handle)
        from_node, to_seq = next(handle).rstrip().split("->")
        graph[int(from_node)].append(i)
        sequences[i] = to_seq

    lines = handle.readlines()
    root = int(lines[0].rstrip().split("->")[0])
    for edge in lines:
        from_node, to_node = edge.rstrip().split("->")
        graph[int(from_node)].append(int(to_node))

    root_tree(graph, root)
    return sequences, graph

def extract_position(graph: Dict[int, List[int]], sequences: Dict[int, str], pos: int) -> Dict[int, str]:
    chars: Dict[int, str] = {}
    for n in get_all_nodes(graph) - get_leaves(graph):
        chars[n] = ""
    for leaf in get_leaves(graph):
        chars[leaf] = sequences[leaf][pos]
    return chars

def ba6f(graph: Dict[int, List[int]], sequences: Dict[int, str]) -> Tuple[int, Dict[int, str]]:
    for n in get_all_nodes(graph) - get_leaves(graph):
        sequences[n] = ""

    total_score = 0
    for pos in range(len(next(iter(sequences.values())))):
        chars = extract_position(graph, sequences, pos)
        score, tbchars = small_parsimony(graph, chars)
        total_score += score
        for k, v in tbchars.items():
            sequences[k] += v

    return total_score, sequences

def small_parsimony(graph: Dict[int, List[int]], chars: Dict[int, str]) -> Tuple[int, Dict[int, str]]:
    bases = ["A", "C", "T", "G"]
    sk: Dict[int, List[int]] = {}
    skp: Dict[int, List[Dict[int, int]]] = {}
    to_process = nodes(graph)

    for leaf in leaves(graph):
        sk[leaf] = [0 if chars[leaf] == c else inf for c in bases]
        to_process.remove(leaf)

    while to_process:
        for n in list(to_process):
            if all(v in sk for v in graph[n]):
                sk[n], skp[n] = [], []
                for k in bases:
                    tot = 0
                    ptr: Dict[int, int] = {}
                    for d, sk_child in [(d, sk[d]) for d in graph[n]]:
                        score = []
                        for i, c in enumerate(bases):
                            score += [sk_child[i] + (0 if c == k else 1)]
                        tot += min(score)
                        ptr[d] = score.index(min(score))
                    skp[n] += [ptr]
                    sk[n] += [tot]
                to_process.remove(n)

    node = root(graph)
    score = min(sk[node])
    return score, traceback(skp, node, sk[node].index(score))

def traceback(skp: Dict[int, List[Dict[int, int]]], node: int, ind: int) -> Dict[int, str]:
    bases = ["A", "C", "T", "G"]
    chars: Dict[int, str] = {}
    chars[node] = bases[ind]
    for k, v in skp[node][ind].items():
        if k in skp:
            chars = chars | traceback(skp, k, v)
    return chars

sample_input = """
4
TCGGCCAA->4
4->TCGGCCAA
CCTGGCTG->4
4->CCTGGCTG
CACAGGAT->5
5->CACAGGAT
TGAGTACC->5
5->TGAGTACC
4->5
5->4
"""

sequences, graph = parse_input(io.StringIO(sample_input.strip()))
total_score, sequences = ba6f(graph, sequences)
print(total_score)
print_edges(graph, sequences, find_root(graph))

81 Implement FarthestFirstTraversal

Given: Integers k and m followed by a set of points Data in m-dimensional space.

Return: A set Centers consisting of k points (centers) resulting from applying FarthestFirstTraversal(Datak), where the first point from Data is chosen as the first center to initialize the algorithm.

81.1 Sample Dataset

3 2
0.0 0.0
5.0 5.0
0.0 5.0
1.0 1.0
2.0 2.0
3.0 3.0
1.0 2.0

81.2 Sample Output

0.0 0.0
5.0 5.0
0.0 5.0

81.3 Solution

from math import sqrt
from typing import List, Tuple, Iterator, TextIO, TypeVar
import io

T = TypeVar('T')

def read_types(file_handle: TextIO, data_type: type) -> Iterator[List[T]]:
    for line in file_handle:
        yield list(map(data_type, line.split()))

def euclidean_distance(point_a: List[float], point_b: List[float]) -> float:
    """Euclidean distance between a pair of n-dimensional points"""
    return sqrt(sum((coord_a - coord_b) ** 2 for coord_a, coord_b in zip(point_a, point_b)))

def nearest_center_distance(data_point: List[float], center_points: List[List[float]]) -> float:
    """Euclidean distance from DataPoint to its closest center"""
    return min(euclidean_distance(data_point, center) for center in center_points)

def farthest_first_traversal(data_points: List[List[float]], num_centers: int) -> List[List[float]]:
    center_points = [data_points[0]]
    while len(center_points) < num_centers:
        distances = [(i, nearest_center_distance(point, center_points)) for i, point in enumerate(data_points)]
        center_points.append(data_points[max(distances, key=lambda x: x[1])[0]])
    return center_points

import io

sample_input = """
3 2
0.0 0.0
5.0 5.0
0.0 5.0
1.0 1.0
2.0 2.0
3.0 3.0
1.0 2.0
"""

file_handle = io.StringIO(sample_input.strip())
num_centers, dimensions = next(read_types(file_handle, int))
data_points = [point for point in read_types(file_handle, float)]
center_points = farthest_first_traversal(data_points, num_centers)
for center in center_points:
    print(*center)

82 Compute the Squared Error Distortion

Squared Error Distortion Problem.

Given: Integers k and m, followed by a set of centers Centers and a set of points Data.

Return: The squared error distortion Distortion(DataCenters).

82.1 Sample Dataset

2 2
2.31 4.55
5.96 9.08
--------
3.42 6.03
6.23 8.25
4.76 1.64
4.47 4.33
3.95 7.61
8.93 2.97
9.74 4.03
1.73 1.28
9.72 5.01
7.27 3.77

82.2 Sample Output

18.246

82.3 Solution

from math import sqrt
import io
from typing import List, Tuple, Iterator, TextIO, TypeVar

T = TypeVar('T')

def read_types(file_handle: TextIO, data_type: type) -> Iterator[List[T]]:
    for line in file_handle:
        yield list(map(data_type, line.split()))

def euclidean_distance(point_a: List[float], point_b: List[float]) -> float:
    """Euclidean distance between a pair of n-dimensional points"""
    return sqrt(sum((coord_a - coord_b) ** 2 for coord_a, coord_b in zip(point_a, point_b)))

def nearest_center_distance(data_point: List[float], center_points: List[List[float]]) -> float:
    """Euclidean distance from DataPoint to its closest center"""
    return min(euclidean_distance(data_point, center) for center in center_points)

def calculate_distortion(data_points: List[List[float]], center_points: List[List[float]]) -> float:
    return (1 / len(data_points)) * sum(nearest_center_distance(point, center_points) ** 2 for point in data_points)

sample_input = """
2 2
2.31 4.55
5.96 9.08
--------
3.42 6.03
6.23 8.25
4.76 1.64
4.47 4.33
3.95 7.61
8.93 2.97
9.74 4.03
1.73 1.28
9.72 5.01
7.27 3.77
"""

file_handle = io.StringIO(sample_input.strip())
num_centers, _ = next(read_types(file_handle, int))
data_generator = read_types(file_handle, float)
center_points = [next(data_generator) for _ in range(num_centers)]
_ = next(file_handle)
data_points = [point for point in data_generator]
print(round(calculate_distortion(data_points, center_points), 3))

83 Implement the Lloyd Algorithm for k-Means Clustering

Implement the Lloyd algorithm.

Given: Integers k and m followed by a set of points Data in m-dimensional space.

Return: A set Centers consisting of k points (centers) resulting from applying the Lloyd algorithm to Data and Centers, where the first k points from Data are selected as the first k centers.

83.1 Sample Dataset

2 2
1.3 1.1
1.3 0.2
0.6 2.8
3.0 3.2
1.2 0.7
1.4 1.6
1.2 1.0
1.2 1.1
0.6 1.5
1.8 2.6
1.2 1.3
1.2 1.0
0.0 1.9

83.2 Sample Output

1.800 2.867
1.060 1.140

83.3 Solution

import numpy as np
import io
from math import sqrt
from typing import List, Iterator, TypeVar, Any

T = TypeVar('T')

def read_types(file_handle: io.StringIO, data_type: type) -> Iterator[List[T]]:
    for line in file_handle:
        yield list(map(data_type, line.split()))

def euclidean_distance(point_a: np.ndarray, point_b: np.ndarray) -> float:
    """Euclidean distance between a pair of n-dimensional points"""
    return sqrt(sum((x - y) ** 2 for x, y in zip(point_a, point_b)))

def nearest_center_assignment(data_point: np.ndarray, center_points: List[np.ndarray]) -> int:
    """Center index that minimises Euclidean distance to point"""
    distances = [euclidean_distance(data_point, center) for center in center_points]
    return distances.index(min(distances))

def compute_center(data_points: List[np.ndarray], assignments: List[int], center_index: int) -> np.ndarray:
    cluster_points = [p for p, a in zip(data_points, assignments) if a == center_index]
    return np.mean(np.array(cluster_points), axis=0) if cluster_points else np.zeros_like(data_points[0])

def k_means(data_points: List[np.ndarray], num_clusters: int, max_iterations: int = 20) -> List[np.ndarray]:
    center_points = data_points[:num_clusters]
    for _ in range(max_iterations):
        assignments = [nearest_center_assignment(point, center_points) for point in data_points]
        center_points = [compute_center(data_points, assignments, i) for i in range(num_clusters)]
    return center_points

sample_input = """
2 2
1.3 1.1
1.3 0.2
0.6 2.8
3.0 3.2
1.2 0.7
1.4 1.6
1.2 1.0
1.2 1.1
0.6 1.5
1.8 2.6
1.2 1.3
1.2 1.0
0.0 1.9
"""

file_handle = io.StringIO(sample_input.strip())
num_clusters, dimensions = next(read_types(file_handle, int))
data_points = [np.array(point) for point in read_types(file_handle, float)]
for center in k_means(data_points, num_clusters):
    print(*[f"{coord:f}" for coord in center])

84 Implement the Soft k-Means Clustering Algorithm

Implement the Soft k-Means Clustering Algorithm.

Given: Integers k and m, followed by a stiffness parameter β, followed by a set of points Data in m-dimensional space.

Return: A set Centers consisting of k points (centers) resulting from applying the soft k-means clustering algorithm. Select the first k points from Data as the first centers for the algorithm and run the algorithm for 100 steps. Results should be accurate up to three decimal places.

84.1 Sample Dataset

2 2
2.7
1.3 1.1
1.3 0.2
0.6 2.8
3.0 3.2
1.2 0.7
1.4 1.6
1.2 1.0
1.2 1.1
0.6 1.5
1.8 2.6
1.2 1.3
1.2 1.0
0.0 1.9

84.2 Sample Output

1.662 2.623
1.075 1.148

84.3 Solution

import numpy as np
from math import sqrt
import io
from typing import List, Iterator, TypeVar, Any

T = TypeVar('T')

def read_types(file_handle: io.StringIO, data_type: type) -> Iterator[List[T]]:
    for line in file_handle:
        yield list(map(data_type, line.split()))

def euclidean_distance(point_a: np.ndarray, point_b: np.ndarray) -> float:
    """Euclidean distance between a pair of n-dimensional points"""
    return sqrt(sum((x - y) ** 2 for x, y in zip(point_a, point_b)))

def partition_function(data_point: np.ndarray, center_points: np.ndarray, beta: float) -> np.ndarray:
    numerator = [np.exp(-beta * euclidean_distance(data_point, center)) for center in center_points]
    return np.array(numerator) / sum(numerator)

def hidden_matrix(data_points: np.ndarray, center_points: np.ndarray, beta: float) -> np.ndarray:
    return np.array([partition_function(x, center_points, beta) for x in data_points])

def soft_k_means(data_points: List[np.ndarray], num_clusters: int, beta: float, max_iterations: int = 20) -> np.ndarray:
    center_points = np.array(data_points[:num_clusters])
    data_points = np.array(data_points)
    for _ in range(max_iterations):
        h_matrix = hidden_matrix(data_points, center_points, beta)
        center_points = [np.dot(h_matrix[:, i], data_points) for i in range(num_clusters)]
        sums = np.sum(h_matrix, 0)
        center_points = np.transpose(np.transpose(center_points) / sums)
    return center_points

sample_input = """
2 2
2.7
1.3 1.1
1.3 0.2
0.6 2.8
3.0 3.2
1.2 0.7
1.4 1.6
1.2 1.0
1.2 1.1
0.6 1.5
1.8 2.6
1.2 1.3
1.2 1.0
0.0 1.9
"""

file_handle = io.StringIO(sample_input.strip())
num_clusters, dimensions = next(read_types(file_handle, int))
beta = next(read_types(file_handle, float))[0]
data_points = [np.array(point) for point in read_types(file_handle, float)]
for center in soft_k_means(data_points, num_clusters, beta):
    print(*[f"{coord:f}" for coord in center])

85 Implement Hierarchical Clustering

Implement Hierarchical Clustering.

Given: An integer n, followed by an n_x_n distance matrix.

Return: The result of applying HierarchicalClustering to this distance matrix (using Davg), with each newly created cluster listed on each line.

85.1 Sample Dataset

7
0.00 0.74 0.85 0.54 0.83 0.92 0.89
0.74 0.00 1.59 1.35 1.20 1.48 1.55
0.85 1.59 0.00 0.63 1.13 0.69 0.73
0.54 1.35 0.63 0.00 0.66 0.43 0.88
0.83 1.20 1.13 0.66 0.00 0.72 0.55
0.92 1.48 0.69 0.43 0.72 0.00 0.80
0.89 1.55 0.73 0.88 0.55 0.80 0.00

85.2 Sample Output

4 6
5 7
3 4 6
1 2
5 7 3 4 6
1 2 5 7 3 4 6

85.3 Solution

import numpy as np
from collections import defaultdict
import io
from typing import List, Tuple, Dict, Generator

# find (first) minimum off diagonal index in an array
def find_closest_pair(distance_matrix: np.ndarray) -> Tuple[int, int]:
    temp_matrix = np.copy(distance_matrix)
    np.fill_diagonal(temp_matrix, temp_matrix.max() + 1)
    return divmod(temp_matrix.argmin(), temp_matrix.shape[1])

def average_distances(distance_matrix: np.ndarray, i: int, j: int, size_i: int, size_j: int) -> np.ndarray:
    temp_matrix = np.copy(distance_matrix)
    average = (temp_matrix[i, :] * size_i + temp_matrix[j, :] * size_j) / (size_i + size_j)
    temp_matrix[i, :] = average
    temp_matrix[:, i] = average
    temp_matrix = np.delete(temp_matrix, j, 0)
    temp_matrix = np.delete(temp_matrix, j, 1)
    np.fill_diagonal(temp_matrix, 0)
    return temp_matrix

def get_descendants(tree: Dict[int, List[int]], node: int) -> List[int]:
    queue = [node]
    descendants = []
    while queue:
        current_node = queue.pop(0)
        if current_node in tree:
            queue.extend(tree[current_node])
        else:
            descendants.append(current_node)
    return descendants

def hierarchical_clustering(distance_matrix: np.ndarray, num_elements: int) -> Generator[List[int], None, None]:
    clusters = list(range(1, num_elements + 1))
    tree: Dict[int, List[int]] = {}
    cluster_size = defaultdict(lambda: 1)  # the number of descendants of a node
    next_node = num_elements
    while len(clusters) > 1:
        next_node += 1
        i, j = find_closest_pair(distance_matrix)
        cluster_a, cluster_b = clusters[i], clusters[j]
        tree[next_node] = [cluster_a, cluster_b]
        cluster_size[next_node] = cluster_size[cluster_a] + cluster_size[cluster_b]
        distance_matrix = average_distances(distance_matrix, *find_closest_pair(distance_matrix), cluster_size[cluster_a], cluster_size[cluster_b])
        clusters[i] = next_node
        del clusters[j]
        yield get_descendants(tree, cluster_a) + get_descendants(tree, cluster_b)

sample_input = """
7
0.00 0.74 0.85 0.54 0.83 0.92 0.89
0.74 0.00 1.59 1.35 1.20 1.48 1.55
0.85 1.59 0.00 0.63 1.13 0.69 0.73
0.54 1.35 0.63 0.00 0.66 0.43 0.88
0.83 1.20 1.13 0.66 0.00 0.72 0.55
0.92 1.48 0.69 0.43 0.72 0.00 0.80
0.89 1.55 0.73 0.88 0.55 0.80 0.00
"""

num_elements, *distance_data = io.StringIO(sample_input.strip()).read().splitlines()
distance_matrix = np.array([list(map(float, row.split())) for row in distance_data])
for step in hierarchical_clustering(distance_matrix, int(num_elements)):
    print(*step)

86 Construct a Trie from a Collection of Patterns

Trie Construction Problem. Construct a trie on a collection of patterns.

Given: A collection of strings Patterns.

Return: The adjacency list corresponding to Trie(Patterns), in the following format. If Trie(Patterns) has n nodes, first label the root with 1 and then label the remaining nodes with the integers 2 through n in any order you like. Each edge of the adjacency list of Trie(Patterns) will be encoded by a triple: the first two members of the triple must be the integers labeling the initial and terminal nodes of the edge, respectively; the third member of the triple must be the symbol labeling the edge.

86.1 Sample Dataset

ATAGA
ATC
GAT

86.2 Sample Output

0->1:A
1->2:T
2->3:A
3->4:G
4->5:A
2->6:C
0->7:G
7->8:A
8->9:T

86.3 Solution

from itertools import count
from typing import List, Dict, Tuple, Any

class Trie:
    def __init__(self) -> None:
        self.id_generator = count(start=0)
        self.root: Tuple[int, Dict[str, Any]] = (next(self.id_generator), {})
    
    def insert(self, sequence: str) -> None:
        current_node = self.root
        for character in sequence:
            if character not in current_node[1]:
                current_node[1][character] = (next(self.id_generator), {})
            current_node = current_node[1][character]
            
def build_trie(sequences: List[str]) -> Tuple[int, Dict[str, Any]]:
    trie = Trie()
    for sequence in sequences:
        trie.insert(sequence)
    return trie.root

def format_trie(node: Tuple[int, Dict[str, Any]]) -> List[str]:
    formatted_output: List[str] = []
    node_id, children = node
    for char, child_node in children.items():
        child_id, _ = child_node
        formatted_output.append(f"{node_id}->{child_id}:{char}")
        formatted_output.extend(format_trie(child_node))
    return formatted_output

sample_input: str = """
ATAGA
ATC
GAT
"""

sequences: List[str] = sample_input.strip().split("\n")

for edge in format_trie(build_trie(sequences)):
    print(edge)

87 Implement TrieMatching

Given: A string Text and a collection of strings Patterns.

Return: All starting positions in Text where a string from Patterns appears as a substring.

87.1 Sample Dataset

AATCGGGTTCAATCGGGGT
ATCG
GGGT

87.2 Sample Output

1 4 11 15

87.3 Solution

from collections import defaultdict
from typing import List, DefaultDict, Set

sample_input: str = """
AATCGGGTTCAATCGGGGT
ATCG
GGGT
"""

sequences: List[str] = sample_input.strip().split("\n")
main_sequence: str = sequences[0]
kmers: List[str] = sequences[1:]

kmer_positions: DefaultDict[str, Set[int]] = defaultdict(set)

kmer_length: int = len(kmers[0])

for start_index in range(len(main_sequence) - kmer_length + 1):
    current_kmer: str = main_sequence[start_index:start_index + kmer_length]
    kmer_positions[current_kmer].add(start_index)

all_positions: Set[int] = set()
for kmer in kmers:
    all_positions.update(kmer_positions[kmer])

sorted_positions: List[int] = sorted(all_positions)
output: str = " ".join(map(str, sorted_positions))

print(output)

88 Construct the Suffix Tree of a String

Suffix Tree Construction Problem. Construct the suffix tree of a string.

Given: A string Text.

Return: The strings labeling the edges of SuffixTree(Text). (You may return these strings in any order.)

88.1 Sample Dataset

ATAAATG$

88.2 Sample Output

AAATG$
G$
T
ATG$
TG$
A
A
AAATG$
G$
T
G$
$

88.3 Solution

from typing import List, Optional

class Tree:
    class Node:
        def __init__(self) -> None:
            self.label: Optional[int] = None
            self.edges: List['Tree.Edge'] = []
            self.indicator: Optional[str] = None
            self.depth: int = 0

    class Edge:
        def __init__(self) -> None:
            self.from_node: Optional['Tree.Node'] = None
            self.target_node: Optional['Tree.Node'] = None
            self.position: Optional[int] = None
            self.length: Optional[int] = None

    def __init__(self) -> None:
        self.all_nodes: List[Tree.Node] = []
        self.all_edges: List[Tree.Edge] = []
        self.root: Tree.Node = self.add_node()

    def add_node(self) -> Node:
        new_node = Tree.Node()
        new_node.label = len(self.all_nodes)
        self.all_nodes.append(new_node)
        return new_node

    def add_edge(self, from_node: Node, target_node: Node, pos: int, length: int) -> Edge:
        new_edge = Tree.Edge()
        new_edge.from_node = from_node
        new_edge.target_node = target_node
        new_edge.position = pos
        new_edge.length = length
        target_node.depth = from_node.depth + length
        from_node.edges.append(new_edge)
        self.all_edges.append(new_edge)
        return new_edge

    def edge_labels(self, text: str) -> List[str]:
        return [text[edge.position : edge.position + edge.length] for edge in self.all_edges]

    def return_ripe_nodes(self) -> List[Node]:
        ripe_nodes = []
        for node in self.all_nodes:
            if node.indicator is None and all(edge.target_node.indicator is not None for edge in node.edges):
                ripe_nodes.append(node)
        return ripe_nodes

    def add_indicators(self) -> None:
        ripe_nodes = self.return_ripe_nodes()
        while ripe_nodes:
            for node in ripe_nodes:
                children_indicators = set(edge.target_node.indicator for edge in node.edges)
                node.indicator = '*' if len(children_indicators) != 1 else next(iter(children_indicators))
            ripe_nodes = self.return_ripe_nodes()

    def construct_suffix_tree(self, trie_node: 'Trie.Node', tree_node: Node, path: List['Trie.Edge'] = []) -> None:
        while len(trie_node.edges) == 1:
            trie_edge = trie_node.edges[0]
            path.append(trie_edge)
            trie_node = trie_edge.target_node

        if path:
            new_tree_node = self.add_node()
            self.add_edge(tree_node, new_tree_node, path[0].position, len(path))
            tree_node = new_tree_node

        if not trie_node.edges:
            tree_node.indicator = trie_node.indicator
            tree_node.label = trie_node.label
            return

        for trie_edge in trie_node.edges:
            self.construct_suffix_tree(trie_edge.target_node, tree_node, [trie_edge])

    def populate_suffix_tree(self, text: str) -> None:
        suffix_trie = Trie()
        suffix_trie.construct_suffix_trie(text)
        self.construct_suffix_tree(suffix_trie.root, self.root)

class Trie:
    class Node:
        def __init__(self) -> None:
            self.label: Optional[int] = None
            self.edges: List['Trie.Edge'] = []
            self.indicator: Optional[str] = None

    class Edge:
        def __init__(self) -> None:
            self.from_node: Optional['Trie.Node'] = None
            self.target_node: Optional['Trie.Node'] = None
            self.label: Optional[str] = None
            self.position: Optional[int] = None

    def __init__(self) -> None:
        self.all_nodes: List[Trie.Node] = []
        self.all_edges: List[Trie.Edge] = []
        self.root: Trie.Node = self.add_node()

    def add_node(self) -> Node:
        new_node = Trie.Node()
        new_node.label = len(self.all_nodes)
        self.all_nodes.append(new_node)
        return new_node

    def add_edge(self, from_node: Node, target_node: Node, label: str, pos: Optional[int] = None) -> Edge:
        new_edge = Trie.Edge()
        new_edge.from_node = from_node
        new_edge.target_node = target_node
        new_edge.label = label
        new_edge.position = pos
        from_node.edges.append(new_edge)
        self.all_edges.append(new_edge)
        return new_edge

    def construct_suffix_trie(self, text: str) -> None:
        indicator = '#'
        for i in range(len(text)):
            current_node = self.root
            for j in range(i, len(text)):
                current_symbol = text[j]
                next_node = next((edge.target_node for edge in current_node.edges if edge.label == current_symbol), None)
                if next_node is None:
                    new_node = self.add_node()
                    self.add_edge(current_node, new_node, current_symbol, j)
                    current_node = new_node
                else:
                    current_node = next_node
            if not current_node.edges:
                current_node.label = f'L{i}'
                current_node.indicator = indicator
            if text[i] == '#':
                indicator = '$'

sample_input = "ATAAATG$"
input_lines = sample_input.strip().split()
text = input_lines[0]

tree = Tree()
tree.populate_suffix_tree(text)

result = tree.edge_labels(text)
print("\n".join(result))

89 Find the Longest Repeat in a String

Longest Repeat Problem, Find the longest repeat in a string.

Given: A string Text.

Return: A longest substring of Text that appears in Text more than once. (Multiple solutions may exist, in which case you may return any one.)

89.1 Sample Dataset

ATATCGTTTTATCGTT

89.2 Sample Output

TATCGTT

89.3 Solution

from functools import cache
from os.path import commonprefix
from typing import Dict, List, Tuple, Generator, Iterator

def get_edges(graph: Dict[str, Dict]) -> Generator[str, None, None]:
    for key in graph.keys():
        yield key
        yield from get_edges(graph[key])

@cache
def suffix_tree(sequence: str, start_positions: Tuple[int, ...]) -> Dict[str, Dict]:
    tree: Dict[str, Dict] = {}
    unique_bases = sorted(set([sequence[start] for start in start_positions]))
    
    for base in unique_bases:
        matching_positions = [start for start in start_positions if sequence[start] == base]
        subsequences = [sequence[s:] for s in matching_positions]
        common_prefix = commonprefix(subsequences)
        prefix_length = len(common_prefix)
        new_start_positions = [start + prefix_length for start in matching_positions if start + prefix_length < len(sequence)]
        tree[common_prefix] = suffix_tree(sequence, tuple(new_start_positions))
    
    return tree

def create_suffix_tree(sequence: str) -> Dict[str, Dict]:
    return suffix_tree(sequence, tuple(range(len(sequence))))

def internal_edges(tree: Dict[str, Dict]) -> Iterator[str]:
    for node in tree.keys():
        if not len(tree[node]):
            yield ""
        for child_edge in internal_edges(tree[node]):
            yield node + child_edge

def longest_shared_substring(tree: Dict[str, Dict]) -> str:
    return max(internal_edges(tree), key=lambda x: len(x))

sample_input = """
ATATCGTTTTATCGTT
"""

sequence = sample_input.strip()
suffix_tree = create_suffix_tree(sequence)
print(longest_shared_substring(suffix_tree))

90 Find the Longest Substring Shared by Two Strings

Longest Shared Substring Problem. Find the longest substring shared by two strings.

Given: Strings _Text_1 and _Text_2.

Return: The longest substring that occurs in both _Text_1 and _Text_2. (Multiple solutions may exist, in which case you may return any one.)

90.1 Sample Dataset

TCGGTAGATTGCGCCCACTC
AGGGGCTCGCAGTGTAAGAA

90.2 Sample Output

AGA

90.3 Solution

from collections import defaultdict
import re
from functools import cache
from os.path import commonprefix
from typing import Dict, List, Set, Tuple, Generator

@cache
def build_suffix_tree(sequence: str, start_positions: Tuple[int, ...]) -> Dict[str, Dict]:
    tree: Dict[str, Dict] = {}
    unique_bases = sorted(set([sequence[start] for start in start_positions]))
    for base in unique_bases:
        matching_positions = [start for start in start_positions if sequence[start] == base]
        subsequences = [sequence[s:] for s in matching_positions]
        common_prefix = commonprefix(subsequences)
        prefix_length = len(common_prefix)
        new_start_positions = [start + prefix_length for start in matching_positions if start + prefix_length < len(sequence)]
        tree[common_prefix] = build_suffix_tree(sequence, tuple(new_start_positions))
    return tree

def create_suffix_tree(sequence: str) -> Dict[str, Dict]:
    return build_suffix_tree(sequence, tuple(range(len(sequence))))

def convert_to_graph(suffix_tree: Dict[str, Dict]) -> Dict[int, List[Dict[str, int]]]:
    def build_graph_structure(subtree: Dict[str, Dict], graph: Dict[int, List[Dict[str, int]]], node_id: int) -> int:
        next_node_id = node_id
        for edge in sorted(subtree):
            next_node_id += 1
            graph[node_id].append({"n": next_node_id, "l": edge})
            next_node_id = build_graph_structure(subtree[edge], graph, next_node_id)
        return next_node_id

    graph: Dict[int, List[Dict[str, int]]] = defaultdict(list)
    build_graph_structure(suffix_tree, graph, 0)
    return graph

def find_leaf_nodes(graph: Dict[int, List[Dict[str, int]]]) -> Set[int]:
    all_child_nodes = set(node["n"] for nodes in graph.values() for node in nodes)
    parent_nodes = set(graph.keys())
    return all_child_nodes - parent_nodes

def reverse_graph_structure(graph: Dict[int, List[Dict[str, int]]]) -> Dict[int, Dict[str, int]]:
    reversed_graph: Dict[int, Dict[str, int]] = {}
    for parent_node, children in graph.items():
        for child in children:
            reversed_graph[child["n"]] = {"n": parent_node, "l": child["l"]}
    return reversed_graph

def get_purple_edges(tree: Dict[int, List[Dict[str, int]]], colors: Dict[int, str]) -> Generator[str, None, None]:
    def _get_purple_edges(node: int, sequence: str) -> Generator[str, None, None]:
        if colors[node] == "purple":
            has_purple_child = any(colors[child["n"]] == "purple" for child in tree[node])
            if has_purple_child:
                for child in tree[node]:
                    yield from _get_purple_edges(child["n"], sequence + child["l"])
            else:
                yield sequence

    yield from _get_purple_edges(0, "")

def initialize_leaf_colors(tree: Dict[int, List[Dict[str, int]]]) -> Dict[int, str]:
    reversed_graph = reverse_graph_structure(tree)
    colors: Dict[int, str] = defaultdict(lambda: None)
    for leaf in find_leaf_nodes(tree):
        edge = reversed_graph[leaf]["l"]
        match = re.search(r"([$#])", edge)
        colors[leaf] = "red" if match.group() == "$" else "blue"
    return colors

def color_tree_nodes(tree: Dict[int, List[Dict[str, int]]], colors: Dict[int, str]) -> Dict[int, str]:
    nodes_to_process = list(tree.keys())
    while nodes_to_process:
        for node in nodes_to_process:
            child_colors = [colors[child["n"]] for child in tree[node]]
            if all(child_colors):
                unique_colors = set(child_colors)
                if unique_colors == {"red"}:
                    colors[node] = "red"
                elif unique_colors == {"blue"}:
                    colors[node] = "blue"
                else:
                    colors[node] = "purple"
                nodes_to_process.remove(node)
    return colors

def find_longest_shared_substring(seq1: str, seq2: str) -> str:
    combined_sequence = seq1 + "$" + seq2 + "#"
    suffix_tree = create_suffix_tree(combined_sequence)
    graph = convert_to_graph(suffix_tree)
    initial_colors = initialize_leaf_colors(graph)
    final_colors = color_tree_nodes(graph, initial_colors)
    return max(get_purple_edges(graph, final_colors), key=len)

sample_input = """
TCGGTAGATTGCGCCCACTC
AGGGGCTCGCAGTGTAAGAA
"""
sequence1, sequence2 = sample_input.strip().split("\n")
print(find_longest_shared_substring(sequence1, sequence2))

91 Find the Shortest Non-Shared Substring of Two Strings

Shortest Non-Shared Substring Problem. Find the shortest substring of one string that does not appear in another string.

Given: Strings _Text_1 and _Text_2.

Return: The shortest substring of _Text_1 that does not appear in _Text_2. (Multiple solutions may exist, in which case you may return any one.)

91.1 Sample Dataset

CCAAGCTGCTAGAGG
CATGCTGGGCTGGCT

91.2 Sample Output

AA

91.3 Solution

from functools import cache
from os.path import commonprefix
from typing import Dict, List, Tuple, Set
from collections import defaultdict
import re

@cache
def build_suffix_tree(sequence: str, start_positions: Tuple[int, ...]) -> Dict[str, Dict]:
    tree: Dict[str, Dict] = {}
    unique_bases = sorted(set([sequence[start] for start in start_positions]))
    for base in unique_bases:
        matching_positions = [start for start in start_positions if sequence[start] == base]
        subsequences = [sequence[s:] for s in matching_positions]
        common_prefix = commonprefix(subsequences)
        prefix_length = len(common_prefix)
        new_start_positions = [start + prefix_length for start in matching_positions if start + prefix_length < len(sequence)]
        tree[common_prefix] = build_suffix_tree(sequence, tuple(new_start_positions))
    return tree

def create_suffix_tree(sequence: str) -> Dict[str, Dict]:
    return build_suffix_tree(sequence, tuple(range(len(sequence))))

def find_leaf_nodes(graph: Dict[int, List[Dict[str, int]]]) -> Set[int]:
    all_child_nodes = set(node["n"] for nodes in graph.values() for node in nodes)
    parent_nodes = set(graph.keys())
    return all_child_nodes - parent_nodes

def reverse_graph_structure(graph: Dict[int, List[Dict[str, int]]]) -> Dict[int, Dict[str, int]]:
    reversed_graph: Dict[int, Dict[str, int]] = {}
    for parent, children in graph.items():
        for child in children:
            reversed_graph[child["n"]] = {"n": parent, "l": child["l"]}
    return reversed_graph

def convert_to_graph(suffix_tree: Dict[str, Dict]) -> Dict[int, List[Dict[str, int]]]:
    def build_graph_structure(subtree: Dict[str, Dict], graph: Dict[int, List[Dict[str, int]]], node_id: int) -> int:
        next_node_id = node_id
        for edge in sorted(subtree):
            next_node_id += 1
            graph[node_id].append({"n": next_node_id, "l": edge})
            next_node_id = build_graph_structure(subtree[edge], graph, next_node_id)
        return next_node_id

    graph: Dict[int, List[Dict[str, int]]] = defaultdict(list)
    build_graph_structure(suffix_tree, graph, 0)
    return graph

def initialize_leaf_colors(tree: Dict[int, List[Dict[str, int]]]) -> Dict[int, str]:
    reversed_graph = reverse_graph_structure(tree)
    colors: Dict[int, str] = defaultdict(lambda: None)
    for leaf in find_leaf_nodes(tree):
        edge = reversed_graph[leaf]["l"]
        match = re.search(r"([$#])", edge)
        colors[leaf] = "red" if match and match.group() == "$" else "blue"
    return colors

def color_tree_nodes(tree: Dict[int, List[Dict[str, int]]], colors: Dict[int, str]) -> Dict[int, str]:
    nodes_to_process = list(tree.keys())
    while nodes_to_process:
        for node in nodes_to_process[:]:
            child_colors = [colors[n["n"]] for n in tree[node]]
            if all(child_colors):
                unique_colors = set(child_colors)
                if unique_colors == {"red"}:
                    colors[node] = "red"
                elif unique_colors == {"blue"}:
                    colors[node] = "blue"
                else:
                    colors[node] = "purple"
                nodes_to_process.remove(node)
    return colors

def find_non_purple_edges(tree: Dict[int, List[Dict[str, int]]], colors: Dict[int, str]):
    def _find_non_purple_edges(node: int, sequence: List[str], path: List[int]):
        if colors[node] == "purple":
            for child in tree[node]:
                yield from _find_non_purple_edges(child["n"], sequence + [child["l"]], path + [node])
        else:
            if colors[node] == "red":
                sequence[-1] = sequence[-1][0]
                joined_sequence = "".join(sequence)
                if "#" not in joined_sequence and "$" not in joined_sequence:
                    yield joined_sequence

    yield from _find_non_purple_edges(0, [], [])

def find_shortest_nonshared_substring(seq1: str, seq2: str) -> str:
    combined_sequence = seq1 + "$" + seq2 + "#"
    suffix_tree = create_suffix_tree(combined_sequence)
    graph = convert_to_graph(suffix_tree)
    initial_colors = initialize_leaf_colors(graph)
    final_colors = color_tree_nodes(graph, initial_colors)
    return min(find_non_purple_edges(graph, final_colors), key=len)

sample_input = """
CCAAGCTGCTAGAGG
CATGCTGGGCTGGCT
"""

sequence1, sequence2 = sample_input.strip().split("\n")
print(find_shortest_nonshared_substring(sequence1, sequence2))

92 Construct the Suffix Array of a String

Suffix Array Construction Problem. Construct the suffix array of a string.

Given: A string Text.

Return: SuffixArray(Text).

92.1 Sample Dataset

AACGATAGCGGTAGA$

92.2 Sample Output

15, 14, 0, 1, 12, 6, 4, 2, 8, 13, 3, 7, 9, 10, 11, 5

92.3 Solution

from typing import List

def create_suffix_array(text: str) -> List[int]:
    """
    Create a suffix array for the given text.

    Args:
    text (str): The input string to create a suffix array for.

    Returns:
    List[int]: A list of indices representing the suffix array.
    """
    suffixes = [(i, text[i:]) for i in range(len(text))]
    sorted_suffixes = sorted(suffixes, key=lambda x: x[1])
    return [index for index, _ in sorted_suffixes]

sample_input = "AACGATAGCGGTAGA$"
suffix_array = create_suffix_array(sample_input.strip())
print(*suffix_array, sep=", ")

93 Pattern Matching with the Suffix Array

Multiple Pattern Matching with the Suffix Array.

Given: A string Text and a collection of strings Patterns.

Return: All starting positions in Text where a string from Patterns appears as a substring.

93.1 Sample Dataset

AATCGGGTTCAATCGGGGT
ATCG
GGGT

93.2 Sample Output

1 4 11 15

93.3 Solution

from typing import List, Tuple

def create_suffix_array(text: str) -> List[int]:
    """
    Create a suffix array for the given text.

    Args:
    text (str): The input string to create a suffix array for.

    Returns:
    List[int]: A list of indices representing the suffix array.
    """
    suffixes: List[Tuple[int, str]] = [(i, text[i:]) for i in range(len(text))]
    sorted_suffixes: List[Tuple[int, str]] = sorted(suffixes, key=lambda x: x[1])
    return [index for index, _ in sorted_suffixes]

def find_pattern_occurrences(text: str, pattern: str, suffix_array: List[int]) -> List[int]:
    """
    Find all occurrences of a pattern in the text using the suffix array.

    Args:
    text (str): The input text to search in.
    pattern (str): The pattern to search for.
    suffix_array (List[int]): The suffix array of the text.

    Returns:
    List[int]: A list of indices where the pattern occurs in the text.
    """
    lower_bound: int = 0
    upper_bound: int = len(text)
    
    while lower_bound < upper_bound:
        mid_point: int = (lower_bound + upper_bound) // 2
        if pattern > text[suffix_array[mid_point]:][: len(pattern)]:
            lower_bound = mid_point + 1
        else:
            upper_bound = mid_point
    
    first_occurrence: int = lower_bound
    upper_bound = len(text)
    
    while lower_bound < upper_bound:
        mid_point: int = (lower_bound + upper_bound) // 2
        if pattern < text[suffix_array[mid_point]:][: len(pattern)]:
            upper_bound = mid_point
        else:
            lower_bound = mid_point + 1
    
    last_occurrence: int = upper_bound
    
    if first_occurrence > last_occurrence:
        return []
    else:
        return list(range(first_occurrence, last_occurrence))

sample_input: str = """
AATCGGGTTCAATCGGGGT
ATCG
GGGT
"""

sequence, *patterns = sample_input.strip().split("\n")
suffix_array: List[int] = create_suffix_array(sequence)
matching_indices: List[int] = []

for pattern in patterns:
    for index in find_pattern_occurrences(sequence, pattern, suffix_array):
        matching_indices.append(suffix_array[index])

print(*sorted(set(matching_indices)))

94 Construct the Burrows-Wheeler Transform of a String

Burrows-Wheeler Transform Construction Problem.Construct the Burrows-Wheeler transform of a string.

Given: A string Text.

Return: BWT(Text).

94.1 Sample Dataset

GCGTGCCTGGTCA$

94.2 Sample Output

ACTGGCT$TGCGGC

94.3 Solution

from typing import List

def create_suffix_array(text: str) -> List[int]:
    """
    Create a suffix array for the given text.

    Args:
    text (str): The input string to create a suffix array for.

    Returns:
    List[int]: A list of indices representing the suffix array.
    """
    suffixes = sorted(range(len(text)), key=lambda i: text[i:])
    return suffixes

def burrows_wheeler_transform(sequence: str) -> str:
    """
    Perform the Burrows-Wheeler Transform on the input sequence.

    Args:
    sequence (str): The input string to transform.

    Returns:
    str: The Burrows-Wheeler Transform of the input sequence.
    """
    suffix_array = create_suffix_array(sequence)
    return ''.join(sequence[i - 1] for i in suffix_array)

sample_input = "GCGTGCCTGGTCA$"
transformed_sequence = burrows_wheeler_transform(sample_input.strip())
print(transformed_sequence)

95 Reconstruct a String from its Burrows-Wheeler Transform

Inverse Burrows-Wheeler Transform Problem. Reconstruct a string from its Burrows-Wheeler transform.

Given: A string Transform (with a single “$” sign).

Return: The string Text such that BWT(Text) = Transform.

95.1 Sample Dataset

TTCCTAACG$A

95.2 Sample Output

TACATCACGT$

95.3 Solution

from collections import defaultdict
from typing import List, Tuple, Generator

def index_characters(sequence: str) -> Generator[Tuple[str, int], None, None]:
    """
    Generate each character with its occurrence number in the sequence.

    Args:
    sequence (str): The input string to index.

    Yields:
    Tuple[str, int]: A tuple containing the character and its occurrence number.
    """
    char_counts = defaultdict(int)
    for char in sequence:
        yield char, char_counts[char]
        char_counts[char] += 1

def burrows_wheeler_transform_inverse(bwt_sequence: str) -> str:
    """
    Perform the inverse Burrows-Wheeler Transform on the input sequence.

    Args:
    bwt_sequence (str): The Burrows-Wheeler transformed string.

    Returns:
    str: The original string before BWT.
    """
    first_column = list(index_characters(sorted(bwt_sequence)))
    last_column = list(index_characters(bwt_sequence))
    
    current_char: Tuple[str, int] = ("$", 0)
    original_sequence: List[str] = []
    
    for _ in range(len(bwt_sequence)):
        current_char = first_column[last_column.index(current_char)]
        original_sequence.append(current_char[0])
    
    return ''.join(original_sequence)

sample_input = "TTCCTAACG$A"
original_sequence = burrows_wheeler_transform_inverse(sample_input.strip())
print(original_sequence)

96 Generate the Last-to-First Mapping of a String

Last-to-First Mapping Problem.

Given: A string Transform and an integer i.

Return: The position LastToFirst(i) in FirstColumn in the Burrows-Wheeler matrix if LastColumn = Transform.

96.1 Sample Dataset

T$GACCA
3

96.2 Sample Output

1

96.3 Solution

from collections import defaultdict
from typing import List, Tuple, Generator

def index_characters(sequence: str) -> Generator[Tuple[str, int], None, None]:
    """
    Generate each character with its occurrence number in the sequence.

    Args:
    sequence (str): The input string to index.

    Yields:
    Tuple[str, int]: A tuple containing the character and its occurrence number.
    """
    char_counts = defaultdict(int)
    for char in sequence:
        yield char, char_counts[char]
        char_counts[char] += 1

def last_to_first_mapping(sequence: str, index: int) -> int:
    """
    Find the mapping from Last column to First column in the Burrows-Wheeler Transform matrix.

    Args:
    sequence (str): The input string (Last column of BWT matrix).
    index (int): The index in the Last column.

    Returns:
    int: The corresponding index in the First column.
    """
    first_column = list(index_characters(sorted(sequence)))
    last_column = list(index_characters(sequence))
    return first_column.index(last_column[index])

sample_input = """
T$GACCA
3
"""
sequence, index_str = sample_input.strip().split("\n")
index = int(index_str)

result = last_to_first_mapping(sequence.strip(), index)
print(result)

97 Implement BWMatching

Implement. BWMatching.

Given: A string BWT(Text), followed by a collection of strings Patterns.

Return: A list of integers, where the i-th integer corresponds to the number of substring matches of the i-th member of Patterns in Text.

97.1 Sample Dataset

TCCTCTATGAGATCCTATTCTATGAAACCTTCA$GACCAAAATTCTCCGGC
CCT CAC GAG CAG ATC

97.2 Sample Output

2 1 1 0 1

97.3 Solution

from typing import List, Dict, Tuple

def BWMatching(bwt: str, patterns: List[str]) -> List[int]:
    def create_count_and_first_occurrence(bwt: str) -> Tuple[Dict[str, List[int]], Dict[str, int]]:
        count: Dict[str, List[int]] = {char: [0] * (len(bwt) + 1) for char in set(bwt)}
        first_occurrence: Dict[str, int] = {}
        sorted_bwt: List[str] = sorted(bwt)
        
        for i, char in enumerate(bwt):
            for c in count:
                count[c][i + 1] = count[c][i]
            count[char][i + 1] += 1
        
        for i, char in enumerate(sorted_bwt):
            if char not in first_occurrence:
                first_occurrence[char] = i
        
        return count, first_occurrence

    def count_matches(pattern: str) -> int:
        top: int = 0
        bottom: int = len(bwt) - 1
        while top <= bottom:
            if pattern:
                symbol: str = pattern[-1]
                pattern = pattern[:-1]
                if symbol in bwt[top:bottom+1]:
                    top = first_occurrence[symbol] + count[symbol][top]
                    bottom = first_occurrence[symbol] + count[symbol][bottom+1] - 1
                else:
                    return 0
            else:
                return bottom - top + 1

    count, first_occurrence = create_count_and_first_occurrence(bwt)
    return [count_matches(pattern) for pattern in patterns]

# Sample input processing
sample_input: str = """
TCCTCTATGAGATCCTATTCTATGAAACCTTCA$GACCAAAATTCTCCGGC
CCT CAC GAG CAG ATC
"""

input_lines: List[str] = sample_input.strip().split("\n")
bwt: str = input_lines[0]
patterns: List[str] = input_lines[1].split()

# Run the BWMatching algorithm
result: List[int] = BWMatching(bwt, patterns)
print(" ".join(map(str, result)))

98 Implement BetterBWMatching

Given: A string BWT(Text), followed by a collection of strings Patterns.

Return: A list of integers, where the i-th integer corresponds to the number of substring matches of the i-th member of Patterns in Text.

98.1 Sample Dataset

GGCGCCGC$TAGTCACACACGCCGTA
ACC CCG CAG

98.2 Sample Output

1 2 1

98.3 Solution

from typing import List, Dict, Tuple

def BetterBWMatching(bwt: str, patterns: List[str]) -> List[int]:
    def preprocess_bwt(bwt: str) -> Tuple[List[str], Dict[str, List[int]], Dict[str, int]]:
        first_column: List[str] = sorted(bwt)
        count: Dict[str, List[int]] = {char: [0] * (len(bwt) + 1) for char in set(bwt)}
        start_index: Dict[str, int] = {char: first_column.index(char) for char in set(bwt)}
        
        for i, char in enumerate(bwt):
            for c in count:
                count[c][i + 1] = count[c][i]
            count[char][i + 1] += 1
        
        return first_column, count, start_index

    def count_occurrences(pattern: str) -> int:
        top: int = 0
        bottom: int = len(bwt) - 1
        
        while top <= bottom:
            if pattern:
                symbol: str = pattern[-1]
                pattern = pattern[:-1]
                if symbol in bwt[top:bottom+1]:
                    top = start_index[symbol] + count[symbol][top]
                    bottom = start_index[symbol] + count[symbol][bottom+1] - 1
                else:
                    return 0
            else:
                return bottom - top + 1

    first_column, count, start_index = preprocess_bwt(bwt)
    return [count_occurrences(pattern) for pattern in patterns]

# Sample input processing
sample_input: str = """
GGCGCCGC$TAGTCACACACGCCGTA
ACC CCG CAG
"""

input_lines: List[str] = sample_input.strip().split("\n")
bwt: str = input_lines[0]
patterns: List[str] = input_lines[1].split()

# Run the BetterBWMatching algorithm
result: List[int] = BetterBWMatching(bwt, patterns)
print(" ".join(map(str, result)))

99 Find All Occurrences of a Collection of Patterns in a String

Multiple Pattern Matching Problem. Find all occurrences of a collection of patterns in a text.

Given: A string Text and a collection of strings Patterns.

Return: All starting positions in Text where a string from Patterns appears as a substring.

99.1 Sample Dataset

AATCGGGTTCAATCGGGGT
ATCG
GGGT

99.2 Sample Output

1 4 11 15

99.3 Solution

from typing import List, Dict, Tuple

def burrows_wheeler_transform(text: str) -> str:
    n = len(text)
    rotations = sorted([text[i:] + text[:i] for i in range(n)])
    bwt = ''.join([rot[-1] for rot in rotations])
    return bwt

def create_checkpoint_array(bwt: str, checkpoint_interval: int) -> Dict[int, Dict[str, int]]:
    symbols = list(set(bwt))
    checkpoint_array = {}
    for idx in range(0, len(bwt), checkpoint_interval):
        checkpoint_array[idx] = {symbol: bwt[:idx].count(symbol) for symbol in symbols}
    return checkpoint_array

def count_symbol(checkpoint_array: Dict[int, Dict[str, int]], idx: int, last_column: str, symbol: str) -> int:
    checkpoints = [x for x in checkpoint_array.keys() if x <= idx]
    nearest_checkpoint = max(checkpoints)
    count = checkpoint_array[nearest_checkpoint][symbol]
    count += last_column[nearest_checkpoint:idx].count(symbol)
    return count

def create_partial_suffix_array(text: str, k: int) -> Dict[int, int]:
    suffixes = [(text[i:], i) for i in range(len(text))]
    sorted_suffixes = sorted(suffixes)
    return {i: pos for i, (_, pos) in enumerate(sorted_suffixes) if pos % k == 0}

def multiple_pattern_matching(first_occurrence: Dict[str, int], last_column: str, pattern: str, checkpoint_array: Dict[int, Dict[str, int]]) -> Tuple[int, int]:
    top = 0
    bottom = len(last_column) - 1

    while top <= bottom:
        if pattern:
            symbol = pattern[-1]
            pattern = pattern[:-1]
            if symbol in last_column[top: bottom + 1]:
                top = first_occurrence[symbol] + count_symbol(checkpoint_array, top, last_column, symbol)
                bottom = first_occurrence[symbol] + count_symbol(checkpoint_array, bottom + 1, last_column, symbol) - 1
            else:
                return -1, -1
        else:
            return top, bottom
    return -1, -1

def find_pattern_occurrences(text: str, patterns: List[str], checkpoint_interval: int = 100) -> List[int]:
    bwt = burrows_wheeler_transform(text + '$')

    first_occurrence = {}
    for idx, symbol in enumerate(sorted(bwt)):
        if symbol not in first_occurrence:
            first_occurrence[symbol] = idx

    checkpoint_array = create_checkpoint_array(bwt, checkpoint_interval)
    partial_suffix_array = create_partial_suffix_array(text + '$', checkpoint_interval)

    positions = []
    for pattern in patterns:
        top, bottom = multiple_pattern_matching(first_occurrence, bwt, pattern, checkpoint_array)
        if top != -1:
            for idx in range(top, bottom + 1):
                offset = 0
                while idx not in partial_suffix_array:
                    idx = first_occurrence[bwt[idx]] + count_symbol(checkpoint_array, idx, bwt, bwt[idx])
                    offset += 1
                positions.append(partial_suffix_array[idx] + offset)

    return sorted(positions)

# Sample input processing
sample_input: str = """
AATCGGGTTCAATCGGGGT
ATCG
GGGT
"""

input_lines = sample_input.strip().split("\n")
text = input_lines[0]
patterns = input_lines[1:]

result = find_pattern_occurrences(text, patterns)
print(' '.join(str(pos) for pos in result))

100 Find All Approximate Occurrences of a Collection of Patterns in a String

Multiple Approximate Pattern Matching Problem. Find all approximate occurrences of a collection of patterns in a text.

Given: A string Text, a collection of strings Patterns, and an integer d.

Return: All positions in Text where a string from Patterns appears as a substring with at most d mismatches.

100.1 Sample Dataset

ACATGCTACTTT
ATT GCC GCTA TATT
1

100.2 Sample Output

2 4 4 6 7 8 9

100.3 Solution

from collections import defaultdict
from copy import copy
from typing import Dict, List, Tuple, Iterator

def suffix_array(text: str) -> List[int]:
    suffixes: Dict[int, str] = {i: text[i:] for i in range(len(text))}
    return sorted(suffixes.keys(), key=lambda x: suffixes[x])

def partial_suffix_array(sequence: str, k: int) -> List[Tuple[int, int]]:
    return [(i, x) for i, x in enumerate(suffix_array(sequence)) if x % k == 0]

def burrows_wheeler_transform(sequence: str) -> str:
    return "".join(sequence[i - 1] for i in suffix_array(sequence))

from itertools import accumulate

def first_occurrence(sequence: str) -> Dict[str, int]:
    unique_letters: List[str] = sorted(set(sequence))
    counts: List[int] = [0] + list(accumulate(sequence.count(x) for x in unique_letters))
    return dict(zip(unique_letters, counts))

def count_symbols(sequence: str) -> List[Dict[str, int]]:
    count: List[Dict[str, int]] = []
    count.append(defaultdict(int))
    for i, symbol in enumerate(sequence):
        count.append(copy(count[i]))
        count[i + 1][symbol] += 1
    return count

def find_location(row: int, psa: Dict[int, int], last_column: str, fo: Dict[str, int], cs: List[Dict[str, int]]) -> int:
    steps: int = 0
    while row not in psa:
        predecessor: str = last_column[row]
        row = fo[predecessor] + cs[row][predecessor]
        steps += 1
    return steps + psa[row]

class BWMatch:
    def __init__(self, sequence: str, k: int = 10):
        self.psa: Dict[int, int] = dict(partial_suffix_array(sequence + "$", k))
        self.sequence: str = burrows_wheeler_transform(sequence + "$")
        self.fo: Dict[str, int] = first_occurrence(self.sequence)
        self.cs: List[Dict[str, int]] = count_symbols(self.sequence)
        self.max_mismatches: int = 0

    def update(self, pointers: Tuple[int, int], x: str) -> Tuple[int, int]:
        top, bottom = pointers
        return (self.fo[x] + self.cs[top][x], self.fo[x] + self.cs[bottom + 1][x] - 1)

    def bwm(self, pattern: str, pointers: Tuple[int, int], mismatch_count: int) -> List[int]:
        if not pattern:
            return list(range(pointers[0], pointers[1] + 1))
        matches: List[int] = []
        pattern, symbol = pattern[:-1], pattern[-1]
        if symbol in self.sequence[pointers[0] : pointers[1] + 1]:
            matches += self.bwm(pattern, self.update(pointers, symbol), mismatch_count)
        if mismatch_count < self.max_mismatches:
            for mismatch in ["A", "C", "G", "T"]:
                if mismatch != symbol:
                    matches += self.bwm(pattern, self.update(pointers, mismatch), mismatch_count + 1)
        return matches

    def match_patterns(self, patterns: List[str], max_mismatches: int) -> Iterator[int]:
        self.max_mismatches = max_mismatches
        for pattern in patterns:
            for match in self.bwm(pattern, (0, len(self.sequence) - 1), 0):
                yield find_location(match, self.psa, self.sequence, self.fo, self.cs)

sample_input: str = """
ACATGCTACTTT
ATT GCC GCTA TATT
1
"""
sequence, patterns, mismatches = sample_input.strip().split("\n")
patterns: List[str] = patterns.split()
mismatches: int = int(mismatches)
matcher: BWMatch = BWMatch(sequence)
print(*sorted(matcher.match_patterns(patterns, mismatches)))

101 Implement TreeColoring

Tree Coloring Problem. Color the internal nodes of a suffix tree given colors of the leaves.

Given: An adjacency list, followed by color labels for leaf nodes.

Return: Color labels for all nodes, in any order.

101.1 Sample Dataset

0 -> {}
1 -> {}
2 -> 0,1
3 -> {}
4 -> {}
5 -> 3,2
6 -> {}
7 -> 4,5,6
-
0: red
1: red
3: blue
4: blue
6: red

101.2 Sample Output

0: red
1: red
2: red
3: blue
4: blue
5: purple
6: red
7: purple

101.3 Solution

from collections import defaultdict
import io
from typing import Dict, List, Union, TextIO

def color_tree(tree: Dict[int, List[Dict[str, int]]], node_colors: Dict[int, Union[str, None]]) -> Dict[int, Union[str, None]]:
    uncolored_nodes = list(tree.keys())
    while uncolored_nodes:
        for node in list(uncolored_nodes):  # Create a copy of uncolored_nodes to iterate over
            child_colors = [node_colors[child["n"]] for child in tree[node] if node_colors[child["n"]] is not None]
            if len(child_colors) == len(tree[node]):  # Check if all children are colored
                if all(color == "red" for color in child_colors):
                    node_colors[node] = "red"
                elif all(color == "blue" for color in child_colors):
                    node_colors[node] = "blue"
                else:
                    node_colors[node] = "purple"
                uncolored_nodes.remove(node)
    return node_colors

def parse_input(input_data: Union[str, TextIO]) -> Tuple[Dict[int, List[Dict[str, int]]], Dict[int, Union[str, None]]]:
    if isinstance(input_data, str):
        if '\n' in input_data:
            # If input_data contains newlines, treat it as a string input
            file_obj = io.StringIO(input_data)
        else:
            # Otherwise, treat it as a filename
            file_obj = open(input_data)
    elif isinstance(input_data, TextIO):
        file_obj = input_data
    else:
        raise ValueError("Input must be a filename, a string, or a file-like object")

    tree: Dict[int, List[Dict[str, int]]] = defaultdict(list)
    node_colors: Dict[int, Union[str, None]] = defaultdict(lambda: None)
    
    parsing_tree = True
    for line in file_obj:
        line = line.strip()
        if line == "-":
            parsing_tree = False
            continue
        
        if parsing_tree:
            if " -> " in line:
                parent, children = line.split(" -> ")
                if children != "{}":
                    for child in children.split(","):
                        tree[int(parent)].append({"n": int(child)})
        else:
            node, color = line.split(": ")
            node_colors[int(node)] = color

    if isinstance(input_data, str) and '\n' not in input_data:
        file_obj.close()
    
    return tree, node_colors

sample_input = """
0 -> {}
1 -> {}
2 -> 0,1
3 -> {}
4 -> {}
5 -> 3,2
6 -> {}
7 -> 4,5,6
-
0: red
1: red
3: blue
4: blue
6: red
"""

tree, node_colors = parse_input(sample_input)
colored_tree = color_tree(tree, node_colors)
for node in sorted(colored_tree.keys()):
    print(f"{node}: {colored_tree[node]}")

102 Construct the Partial Suffix Array of a String

Partial Suffix Array Construction Problem. Construct the partial suffix array of a string.

Given: A string Text and a positive integer K.

Return: *SuffixArray__K(Text), in the form of a list of ordered pairs (iSuffixArray(i*)) for all nonempty entries in the partial suffix array.

102.1 Sample Dataset

PANAMABANANAS$
5

102.2 Sample Output

1,5
11,10
12,0

102.3 Solution

from typing import List, Dict, Tuple

def suffix_array(text: str) -> List[int]:
    suffixes: Dict[int, str] = {i: text[i:] for i in range(len(text))}
    return sorted(suffixes.keys(), key=lambda x: suffixes[x])

def partial_suffix_array(sequence: str, step: int) -> List[Tuple[int, int]]:
    return [(index, position) for index, position in enumerate(suffix_array(sequence)) if position % step == 0]

sample_input: str = """
PANAMABANANAS$
5
"""

sequence, step_str = sample_input.strip().split("\n")
step: int = int(step_str)

for entry in partial_suffix_array(sequence, step):
    print(*entry, sep=",")

103 Construct a Suffix Tree from a Suffix Array

Suffix Tree Construction from Suffix Array Problem. Construct a suffix tree from the suffix array and LCP array of a string.

Given: A string TextSuffixArray(Text), and LCP(Text).

Return: The strings labeling the edges of SuffixTree(Text). (You may return these strings in any order.)

103.1 Sample Dataset

GTAGT$
5, 2, 3, 0, 4, 1
0, 0, 0, 2, 0, 1

103.2 Sample Output

$
$
$
AGT$
AGT$
AGT$
GT
T

103.3 Solution

from typing import Dict, List, Union

class Node:
    def __init__(self, parent: Union[int, str, None] = None, label: str = ""):
        self.parent: Union[int, str, None] = parent
        self.label: str = label

def calculate_depth(tree: Dict[Union[int, str], Node], node: Union[int, str]) -> int:
    """
    Calculate the length of the concatenation of all path labels from the root to node
    """
    depth: int = len(tree[node].label)
    while tree[node].parent is not None:
        node = tree[node].parent
        depth += len(tree[node].label)
    return depth

def construct_suffix_tree(text: str, suffix_array: List[int], lcp_array: List[int]) -> Dict[Union[int, str], Node]:
    tree: Dict[Union[int, str], Node] = {-1: Node()}

    for i in range(len(text)):
        current_node: int = i - 1
        while tree[current_node].parent is not None and calculate_depth(tree, current_node) > lcp_array[i]:
            current_node = tree[current_node].parent
        current_depth: int = calculate_depth(tree, current_node)

        if lcp_array[i] == current_depth:
            tree[i] = Node(current_node, text[suffix_array[i] + lcp_array[i]:])
        else:
            temp_node: int = i - 1
            while tree[temp_node].parent is not None and tree[temp_node].parent != current_node:
                temp_node = tree[temp_node].parent

            new_node_key: str = f"y{i}"
            tree[new_node_key] = Node(current_node, text[suffix_array[i - 1] + current_depth : suffix_array[i - 1] + lcp_array[i]])
            tree[temp_node] = Node(new_node_key, text[suffix_array[i - 1] + lcp_array[i] : suffix_array[i - 1] + calculate_depth(tree, temp_node)])
            tree[i] = Node(new_node_key, text[suffix_array[i] + lcp_array[i]:])

    del tree[-1]
    return tree

sample_input: str = """
GTAGT$
5, 2, 3, 0, 4, 1
0, 0, 0, 2, 0, 1
"""

text, suffix_array_str, lcp_array_str = sample_input.strip().split("\n")
suffix_array: List[int] = [int(x) for x in suffix_array_str.split(", ")]
lcp_array: List[int] = [int(x) for x in lcp_array_str.split(", ")]

suffix_tree: Dict[Union[int, str], Node] = construct_suffix_tree(text, suffix_array, lcp_array)
labels: List[str] = [suffix_tree[key].label for key in suffix_tree.keys()]
print(*sorted(labels), sep="\n")

104 Compute the Probability of a Hidden Path

Given: A hidden path \(π\) followed by the states States and transition matrix Transition of an HMM (\(Σ\)StatesTransitionEmission).

Return: The probability of this path, \(Pr(π)\). You may assume that initial probabilities are equal.

104.1 Sample Dataset

AABBBAABABAAAABBBBAABBABABBBAABBAAAABABAABBABABBAB
--------
A   B
--------
    A   B
A   0.194   0.806
B   0.273   0.727

104.2 Sample Output

5.01732865318e-19

104.3 Solution

from math import prod
from io import StringIO

def parse_hidden_path_data(input_lines):
    hidden_path = next(input_lines).strip()
    next(input_lines)  # Skip separator
    states = next(input_lines).split()
    next(input_lines)  # Skip separator
    next(input_lines)  # Skip column headers
    
    transition_probabilities = {}
    for line in input_lines:
        if line.strip():
            row_data = line.split()
            current_state = row_data[0]
            for next_state, probability in zip(states, row_data[1:]):
                transition_probabilities[(current_state, next_state)] = float(probability)
    
    return hidden_path, transition_probabilities

def calculate_hidden_path_probability(hidden_path, transition_probabilities):
    initial_probability = 0.5
    path_probability = initial_probability * prod(
        transition_probabilities[state_pair] 
        for state_pair in zip(hidden_path, hidden_path[1:])
    )
    return path_probability

sample_input = """
AABBBAABABAAAABBBBAABBABABBBAABBAAAABABAABBABABBAB
--------
A B
--------
    A   B
A   0.194   0.806
B   0.273   0.727
"""

input_lines = iter(StringIO(sample_input.strip()).readlines())
hidden_path, transition_probabilities = parse_hidden_path_data(input_lines)
result_probability = calculate_hidden_path_probability(hidden_path, transition_probabilities)
print(f"{result_probability:e}")

105 Compute the Probability of an Outcome Given a Hidden Path

Given: A string x, followed by the alphabet Σ from which x was constructed, followed by a hidden path π, followed by the states States and emission matrix Emission of an HMM (ΣStatesTransitionEmission).

Return: The conditional probability \(Pr(x|π)\) that string x will be emitted by the HMM given the hidden path π.

105.1 Sample Dataset

xxyzyxzzxzxyxyyzxxzzxxyyxxyxyzzxxyzyzxzxxyxyyzxxzx
--------
x   y   z
--------
BBBAAABABABBBBBBAAAAAABAAAABABABBBBBABAABABABABBBB
--------
A   B
--------
    x   y   z
A   0.612   0.314   0.074 
B   0.346   0.317   0.336

105.2 Sample Output

1.93157070893e-28

105.3 Solution

from math import prod
from io import StringIO

def parse_emission_data(input_lines):
    emission_sequence = next(input_lines).strip()
    next(input_lines)  # Skip separator
    symbols = next(input_lines).split()
    next(input_lines)  # Skip separator
    hidden_path = next(input_lines).strip()
    next(input_lines)  # Skip separator
    states = next(input_lines).split()
    next(input_lines)  # Skip separator
    next(input_lines)  # Skip column headers
    
    emission_probabilities = {}
    for line in input_lines:
        if line.strip():
            row_data = line.split()
            state = row_data[0]
            for symbol, probability in zip(symbols, row_data[1:]):
                emission_probabilities[(state, symbol)] = float(probability)
    
    return emission_sequence, hidden_path, emission_probabilities

def calculate_emission_probability(emission_sequence, hidden_path, emission_probabilities):
    return prod(emission_probabilities[state_symbol] for state_symbol in zip(hidden_path, emission_sequence))

sample_input = """
xxyzyxzzxzxyxyyzxxzzxxyyxxyxyzzxxyzyzxzxxyxyyzxxzx
--------
x y z
--------
BBBAAABABABBBBBBAAAAAABAAAABABABBBBBABAABABABABBBB
--------
A B
--------
    x   y   z
A   0.612   0.314   0.074 
B   0.346   0.317   0.336
"""

input_lines = iter(StringIO(sample_input.strip()).readlines())
emission_sequence, hidden_path, emission_probabilities = parse_emission_data(input_lines)
result_probability = calculate_emission_probability(emission_sequence, hidden_path, emission_probabilities)
print(f"{result_probability:e}")

106 Implement the Viterbi Algorithm

Given: A string x, followed by the alphabet Σ from which x was constructed, followed by the states States, transition matrix Transition, and emission matrix Emission of an HMM (ΣStatesTransitionEmission).

Return: A path that maximizes the (unconditional) probability Pr(xπ) over all possible paths π.

106.1 Sample Dataset

xyxzzxyxyy
--------
x   y   z
--------
A   B
--------
    A   B
A   0.641   0.359
B   0.729   0.271
--------
    x   y   z
A   0.117   0.691   0.192   
B   0.097   0.42    0.483

106.2 Sample Output

AAABBAAAAA

106.3 Solution

from io import StringIO
from math import log
from typing import List, Dict, Tuple, Iterator
import numpy as np

def parse_input(input_iterator: Iterator[str]) -> Tuple[str, List[str], Dict[Tuple[str, str], float], Dict[Tuple[str, str], float]]:
    sequence = next(input_iterator).rstrip()
    next(input_iterator)
    alphabet = next(input_iterator).split()
    next(input_iterator)
    states = next(input_iterator).split()
    next(input_iterator)
    
    transition_lines = [next(input_iterator) for _ in range(len(states) + 1)]
    transition_matrix = {
        (states[i], states[j]): float(value)
        for i, row in enumerate(transition_lines[1:])
        for j, value in enumerate(row.split()[1:])
    }
    
    next(input_iterator)
    emission_lines = [next(input_iterator) for _ in range(len(states) + 1)]
    emission_matrix = {
        (states[i], alphabet[j]): float(value)
        for i, row in enumerate(emission_lines[1:])
        for j, value in enumerate(row.split()[1:])
    }
    
    return sequence, states, transition_matrix, emission_matrix

def viterbi(sequence: str, states: List[str], transition_matrix: Dict[Tuple[str, str], float], emission_matrix: Dict[Tuple[str, str], float]) -> str:
    num_states = len(states)
    sequence_length = len(sequence)
    viterbi_matrix = np.zeros((sequence_length, num_states))
    backpointer = np.zeros((sequence_length, num_states), dtype=int)

    # Initialize the first column of the viterbi matrix
    for i, state in enumerate(states):
        viterbi_matrix[0, i] = log(emission_matrix[state, sequence[0]] / num_states)

    # Fill in the rest of the viterbi matrix
    for t in range(1, sequence_length):
        for j, current_state in enumerate(states):
            probabilities = [
                log(transition_matrix[previous_state, current_state]) + 
                log(emission_matrix[current_state, sequence[t]]) + 
                viterbi_matrix[t-1, k]
                for k, previous_state in enumerate(states)
            ]
            max_prob_index = probabilities.index(max(probabilities))
            backpointer[t, j] = max_prob_index
            viterbi_matrix[t, j] = max(probabilities)

    best_path_index = np.argmax(viterbi_matrix[-1, :])
    best_path = states[best_path_index]
    for t in range(sequence_length - 1, 0, -1):
        best_path_index = backpointer[t, best_path_index]
        best_path = states[best_path_index] + best_path

    return best_path

# Example usage
sample_input = """
xyxzzxyxyy
--------
x   y   z
--------
A   B
--------
    A   B
A   0.641   0.359
B   0.729   0.271
--------
    x   y   z
A   0.117   0.691   0.192   
B   0.097   0.42    0.483
"""

input_lines = iter(StringIO(sample_input.strip()).readlines())
sequence, states, transition_matrix, emission_matrix = parse_input(input_lines)
result = viterbi(sequence, states, transition_matrix, emission_matrix)
print(result)

107 Compute the Probability of a String Emitted by an HMM

Given: A string x, followed by the alphabet Σ from which x was constructed, followed by the states States, transition matrix Transition, and emission matrix Emission of an HMM (ΣStatesTransitionEmission).

Return: The probability Pr(x) that the HMM emits x.

107.1 Sample Dataset

xzyyzzyzyy
--------
x   y   z
--------
A   B
--------
    A   B
A   0.303   0.697 
B   0.831   0.169 
--------
    x   y   z
A   0.533   0.065   0.402 
B   0.342   0.334   0.324

107.2 Sample Output

1.1005510319694847e-06

107.3 Solution

from io import StringIO
import numpy as np

def parse_hmm_input(input_iterator):
    sequence = next(input_iterator).rstrip()
    next(input_iterator)
    alphabet = next(input_iterator).split()
    next(input_iterator)
    states = next(input_iterator).split()
    next(input_iterator)
    
    transition_lines = [next(input_iterator) for _ in range(len(states) + 1)]
    transition_matrix = {
        (states[i], states[j]): float(value)
        for i, row in enumerate(transition_lines[1:])
        for j, value in enumerate(row.split()[1:])
    }
    
    next(input_iterator)
    emission_lines = [next(input_iterator) for _ in range(len(states) + 1)]
    emission_matrix = {
        (states[i], alphabet[j]): float(value)
        for i, row in enumerate(emission_lines[1:])
        for j, value in enumerate(row.split()[1:])
    }
    
    return sequence, states, transition_matrix, emission_matrix

def calculate_hmm_likelihood(sequence, states, transition_matrix, emission_matrix):
    probability_matrix = np.ones((len(sequence) + 1, len(states)))

    for i, state in enumerate(states):
        probability_matrix[0, i] = emission_matrix[state, sequence[0]] / len(states)

    for i, emission in enumerate(sequence[1:], start=1):
        for j, current_state in enumerate(states):
            probability_matrix[i, j] = sum(
                transition_matrix[previous_state, current_state] * 
                emission_matrix[current_state, emission] * 
                probability_matrix[i - 1, k]
                for k, previous_state in enumerate(states)
            )

    return sum(probability_matrix[i, :])

sample_input = """
xzyyzzyzyy
--------
x   y   z
--------
A   B
--------
    A   B
A   0.303   0.697 
B   0.831   0.169 
--------
    x   y   z
A   0.533   0.065   0.402 
B   0.342   0.334   0.324
"""

input_lines = iter(StringIO(sample_input.strip()).readlines())
sequence, states, transition_matrix, emission_matrix = parse_hmm_input(input_lines)
result = calculate_hmm_likelihood(sequence, states, transition_matrix, emission_matrix)
print(result)

108 Construct a Profile HMM

Given: A threshold θ, followed by an alphabet Σ, followed by a multiple alignment Alignment whose strings are formed from Σ.

Return: The transition and emission probabilities of the profile HMM HMM(Alignmentθ).

108.1 Sample Dataset

0.289
--------
A   B   C   D   E
--------
EBA
EBD
EB-
EED
EBD
EBE
E-D
EBD

108.2 Sample Output

S   I0  M1  D1  I1  M2  D2  I2  M3  D3  I3  E
S   0   0   1.0 0   0   0   0   0   0   0   0   0
I0  0   0   0   0   0   0   0   0   0   0   0   0
M1  0   0   0   0   0   0.875   0.125   0   0   0   0   0
D1  0   0   0   0   0   0   0   0   0   0   0   0
I1  0   0   0   0   0   0   0   0   0   0   0   0
M2  0   0   0   0   0   0   0   0   0.857   0.143   0   0
D2  0   0   0   0   0   0   0   0   1.0 0   0   0
I2  0   0   0   0   0   0   0   0   0   0   0   0
M3  0   0   0   0   0   0   0   0   0   0   0   1.0
D3  0   0   0   0   0   0   0   0   0   0   0   1.0
I3  0   0   0   0   0   0   0   0   0   0   0   0
E   0   0   0   0   0   0   0   0   0   0   0   0
--------
    A   B   C   D   E
S   0   0   0   0   0
I0  0   0   0   0   0
M1  0   0   0   0   1.0
D1  0   0   0   0   0
I1  0   0   0   0   0
M2  0   0.857   0   0   0.143
D2  0   0   0   0   0
I2  0   0   0   0   0
M3  0.143   0   0   0.714   0.143
D3  0   0   0   0   0
I3  0   0   0   0   0
E   0   0   0   0   0

108.3 Solution

import numpy as np
from io import StringIO
from typing import List, Tuple, Iterator

def parse_hmm_input(input_iterator: Iterator[str]) -> Tuple[float, List[str], np.ndarray]:
    threshold = float(next(input_iterator).rstrip())
    next(input_iterator)
    alphabet = next(input_iterator).split()
    next(input_iterator)
    alignment = np.array([list(sequence.strip()) for sequence in input_iterator])
    return threshold, alphabet, alignment

def calculate_state_index(position: int, state_type: str) -> int:
    if state_type == "ins":
        return (position + 1) * 3 + 1
    else:
        return {"match": 0, "del": 1}[state_type] + 3 * position + 2

def normalize_row(row: np.ndarray, include_zeros: bool = False, min_value: float = 0.0) -> np.ndarray:
    if include_zeros and sum(row) == 0:
        row[:] = 1
    with np.errstate(divide="ignore", invalid="ignore"):
        normalized = row / sum(row)
        normalized[row == 0.0] = min_value
        return normalized

def normalize_matrix(matrix: np.ndarray, include_zeros: bool = False, min_value: float = 0.0) -> np.ndarray:
    return np.array([normalize_row(row, include_zeros=include_zeros, min_value=min_value) for row in matrix])

def print_matrix(matrix: np.ndarray, row_labels: List[str], column_labels: List[str]) -> None:
    print(*column_labels, sep="\t")
    for i, row in enumerate(matrix):
        formatted_row = [row_labels[i]] + [round(x, 3) if x > 0.0 else "0" for x in row]
        print(*formatted_row, sep="\t")

def print_transition_probabilities(transition_matrix: np.ndarray) -> None:
    n = (transition_matrix.shape[0] - 3) // 3
    print_matrix(transition_matrix, generate_state_labels(n), generate_state_labels(n))

def print_emission_probabilities(emission_matrix: np.ndarray, alphabet: List[str]) -> None:
    n = (emission_matrix.shape[0] - 3) // 3
    print_matrix(emission_matrix, generate_state_labels(n), alphabet)

def generate_state_labels(n: int) -> List[str]:
    labels = ["S", "I0"]
    for i in range(1, n + 1):
        labels += [f"M{i}", f"D{i}", f"I{i}"]
    labels.append("E")
    return labels

def create_transition_matrix(n: int) -> np.ndarray:
    return np.zeros((n * 3 + 3, n * 3 + 3), dtype=float)

def create_emission_matrix(n: int, m: int) -> np.ndarray:
    return np.zeros((n * 3 + 3, m), dtype=float)

def build_profile_hmm(threshold: float, alphabet: List[str], alignment: np.ndarray) -> Tuple[np.ndarray, np.ndarray]:
    valid_columns = np.mean(alignment == "-", axis=0) < threshold
    valid_column_count = sum(valid_columns)
    end_state = valid_column_count * 3 + 2
    transition_probs = create_transition_matrix(valid_column_count)
    emission_probs = create_emission_matrix(valid_column_count, len(alphabet))

    for sequence in alignment:
        prev_index = 0
        column_index = -1
        for i, char in enumerate(sequence):
            if valid_columns[i]:
                column_index += 1
                if char == "-":
                    current_index = calculate_state_index(column_index, "del")
                else:
                    current_index = calculate_state_index(column_index, "match")
                transition_probs[prev_index, current_index] += 1
                prev_index = current_index
            else:
                if char != "-":
                    current_index = calculate_state_index(column_index, "ins")
                    transition_probs[prev_index, current_index] += 1
                    prev_index = current_index
            if char != "-":
                emission_probs[current_index, alphabet.index(char)] += 1
        transition_probs[prev_index, end_state] += 1

    transition_probs = normalize_matrix(transition_probs)
    emission_probs = normalize_matrix(emission_probs)

    return transition_probs, emission_probs

sample_input = """
0.289
--------
A   B   C   D   E
--------
EBA
EBD
EB-
EED
EBD
EBE
E-D
EBD
"""

input_lines = iter(StringIO(sample_input.strip()).readlines())
threshold, alphabet, alignment = parse_hmm_input(input_lines)
transition_probs, emission_probs = build_profile_hmm(threshold, alphabet, alignment)
print_transition_probabilities(transition_probs)
print("--------")
print_emission_probabilities(emission_probs, alphabet)

109 Construct a Profile HMM with Pseudocounts

Given: A threshold θ and a pseudocount σ, followed by an alphabet Σ, followed by a multiple alignment Alignment whose strings are formed from Σ.

Return: The transition and emission probabilities of the profile HMM HMM(Alignmentθσ).

109.1 Sample Dataset

0.358   0.01
--------
A   B   C   D   E
--------
ADA
ADA
AAA
ADC
-DA
D-A

109.2 Sample Output

S   I0  M1  D1  I1  M2  D2  I2  M3  D3  I3  E
S   0   0.01    0.819   0.172   0   0   0   0   0   0   0   0
I0  0   0.333   0.333   0.333   0   0   0   0   0   0   0   0
M1  0   0   0   0   0.01    0.786   0.204   0   0   0   0   0
D1  0   0   0   0   0.01    0.981   0.01    0   0   0   0   0
I1  0   0   0   0   0.333   0.333   0.333   0   0   0   0   0
M2  0   0   0   0   0   0   0   0.01    0.981   0.01    0   0
D2  0   0   0   0   0   0   0   0.01    0.981   0.01    0   0
I2  0   0   0   0   0   0   0   0.333   0.333   0.333   0   0
M3  0   0   0   0   0   0   0   0   0   0   0.01    0.99
D3  0   0   0   0   0   0   0   0   0   0   0.5 0.5
I3  0   0   0   0   0   0   0   0   0   0   0.5 0.5
E   0   0   0   0   0   0   0   0   0   0   0   0
--------
    A   B   C   D   E
S   0   0   0   0   0
I0  0.2 0.2 0.2 0.2 0.2
M1  0.771   0.01    0.01    0.2 0.01
D1  0   0   0   0   0
I1  0.2 0.2 0.2 0.2 0.2
M2  0.2 0.01    0.01    0.771   0.01
D2  0   0   0   0   0
I2  0.2 0.2 0.2 0.2 0.2
M3  0.803   0.01    0.168   0.01    0.01
D3  0   0   0   0   0
I3  0.2 0.2 0.2 0.2 0.2
E   0   0   0   0   0

109.3 Solution

import numpy as np
from io import StringIO
from typing import List, Tuple

def normalize_matrix(matrix: np.ndarray, include_zeros: bool = False, min_value: float = 0.0) -> np.ndarray:
    return np.array([normalize_row(row, include_zeros=include_zeros, min_value=min_value) for row in matrix])

def normalize_row(row: np.ndarray, include_zeros: bool = False, min_value: float = 0.0) -> np.ndarray:
    if include_zeros and sum(row) == 0:
        row[:] = 1
    with np.errstate(divide="ignore", invalid="ignore"):
        normalized = row / sum(row)
        normalized[row == 0.0] = min_value
        return normalized

def print_matrix(matrix: np.ndarray, row_labels: List[str], col_labels: List[str]) -> None:
    print(*col_labels, sep="\t")
    for i, row in enumerate(matrix):
        formatted_row = [row_labels[i]] + [round(x, 3) if x > 0.0 else "0" for x in row]
        print(*formatted_row, sep="\t")

def print_transition_probs(transition_matrix: np.ndarray) -> None:
    n = (transition_matrix.shape[0] - 3) // 3
    print_matrix(transition_matrix, generate_state_labels(n), generate_state_labels(n))

def print_emission_probs(emission_matrix: np.ndarray, alphabet: List[str]) -> None:
    n = (emission_matrix.shape[0] - 3) // 3
    print_matrix(emission_matrix, generate_state_labels(n), alphabet)

def generate_state_labels(n: int) -> List[str]:
    labels = ["S", "I0"]
    for i in range(1, n + 1):
        labels += [f"M{i}", f"D{i}", f"I{i}"]
    labels.append("E")
    return labels

def create_transition_matrix(n: int) -> np.ndarray:
    return np.zeros((n * 3 + 3, n * 3 + 3), dtype=float)

def create_emission_matrix(n: int, m: int) -> np.ndarray:
    return np.zeros((n * 3 + 3, m), dtype=float)

def calculate_state_index(position: int, state_type: str) -> int:
    if state_type == "ins":
        return (position + 1) * 3 + 1
    else:
        return {"match": 0, "del": 1}[state_type] + 3 * position + 2

def build_profile_hmm(threshold: float, alphabet: List[str], alignment: np.ndarray) -> Tuple[np.ndarray, np.ndarray]:
    valid_columns = np.mean(alignment == "-", axis=0) < threshold
    valid_column_count = sum(valid_columns)
    end_state = valid_column_count * 3 + 2
    transition_probs = create_transition_matrix(valid_column_count)
    emission_probs = create_emission_matrix(valid_column_count, len(alphabet))

    for sequence in alignment:
        prev_index = 0
        column_index = -1
        for i, char in enumerate(sequence):
            if valid_columns[i]:
                column_index += 1
                if char == "-":
                    current_index = calculate_state_index(column_index, "del")
                else:
                    current_index = calculate_state_index(column_index, "match")
                transition_probs[prev_index, current_index] += 1
                prev_index = current_index
            else:
                if char != "-":
                    current_index = calculate_state_index(column_index, "ins")
                    transition_probs[prev_index, current_index] += 1
                    prev_index = current_index
            if char != "-":
                emission_probs[current_index, alphabet.index(char)] += 1
        transition_probs[prev_index, end_state] += 1

    transition_probs = normalize_matrix(transition_probs)
    emission_probs = normalize_matrix(emission_probs)

    return transition_probs, emission_probs

def parse_input(input_handle: Iterator[str]) -> Tuple[float, float, List[str], np.ndarray]:
    threshold, pseudocount = map(float, next(input_handle).rstrip().split())
    next(input_handle)
    alphabet = next(input_handle).split()
    next(input_handle)
    alignment = np.array([list(sequence.strip()) for sequence in input_handle])
    return threshold, pseudocount, alphabet, alignment

def add_transition_pseudocounts(transition_matrix: np.ndarray, pseudocount: float) -> np.ndarray:
    n = (transition_matrix.shape[0] - 3) // 3
    transition_matrix[0, 1:4] += pseudocount
    transition_matrix[1, 1:4] += pseudocount
    for i in range(n):
        transition_matrix[i * 3 + 2 : i * 3 + 5, (i + 1) * 3 + 1 : (i + 1) * 3 + 4] += pseudocount
    return normalize_matrix(transition_matrix)

def add_emission_pseudocounts(emission_matrix: np.ndarray, pseudocount: float) -> np.ndarray:
    n = (emission_matrix.shape[0] - 3) // 3
    emission_matrix[1, :] += pseudocount
    for i in range(n):
        emission_matrix[i * 3 + 2, :] += pseudocount
        emission_matrix[i * 3 + 4, :] += pseudocount
    return normalize_matrix(emission_matrix)

def build_pseudocount_profile_hmm(threshold: float, pseudocount: float, alphabet: List[str], alignment: np.ndarray) -> Tuple[np.ndarray, np.ndarray]:
    transition_probs, emission_probs = build_profile_hmm(threshold, alphabet, alignment)
    transition_probs = add_transition_pseudocounts(transition_probs, pseudocount)
    emission_probs = add_emission_pseudocounts(emission_probs, pseudocount)
    return transition_probs, emission_probs

sample_input = """
0.358   0.01
--------
A   B   C   D   E
--------
ADA
ADA
AAA
ADC
-DA
D-A
"""

input_lines = iter(StringIO(sample_input.strip()).readlines())
threshold, pseudocount, alphabet, alignment = parse_input(input_lines)
transition_probs, emission_probs = build_pseudocount_profile_hmm(threshold, pseudocount, alphabet, alignment)
print_transition_probs(transition_probs)
print("--------")
print_emission_probs(emission_probs, alphabet)

110 Perform a Multiple Sequence Alignment with a Profile HMM

Given: A string Text, a multiple alignment Alignment, a threshold θ, and a pseudocount σ.

Return: An optimal hidden path emitting Text in HMM(Alignment,θ,σ).

110.1 Sample Dataset

AEFDFDC
--------
0.4 0.01
--------
A   B   C   D   E   F
--------
ACDEFACADF
AFDA---CCF
A--EFD-FDC
ACAEF--A-C
ADDEFAAADF

110.2 Sample Output

M1 D2 D3 M4 M5 I5 M6 M7 M8

110.3 Solution

from io import StringIO
from collections import defaultdict
from typing import List, Tuple, Dict, Iterator
import numpy as np
from math import inf, log

def generate_state_labels(num_states: int) -> List[str]:
    labels = ["S", "I0"]
    for i in range(1, num_states + 1):
        labels.extend([f"M{i}", f"D{i}", f"I{i}"])
    labels.append("E")
    return labels

def normalize_row(row: np.ndarray, include_zeros: bool = False, minimum_value: float = 0.0) -> np.ndarray:
    if include_zeros and sum(row) == 0:
        row[:] = 1
    with np.errstate(divide="ignore", invalid="ignore"):
        normalized = row / sum(row)
        normalized[row == 0.0] = minimum_value
        return normalized

def normalize_matrix(matrix: np.ndarray, include_zeros: bool = False, minimum_value: float = 0.0) -> np.ndarray:
    return np.array([normalize_row(r, include_zeros=include_zeros, minimum_value=minimum_value) for r in matrix])

def create_transition_matrix(num_states: int) -> np.ndarray:
    return np.zeros((num_states * 3 + 3, num_states * 3 + 3), dtype=float)

def create_emission_matrix(num_states: int, num_symbols: int) -> np.ndarray:
    return np.zeros((num_states * 3 + 3, num_symbols), dtype=float)

def calculate_index(state_num: int, state_type: str) -> int:
    if state_type == "ins":
        return (state_num + 1) * 3 + 1
    else:
        return {"match": 0, "del": 1}[state_type] + 3 * state_num + 2

def build_profile_hmm(threshold: float, alphabet: List[str], alignment: np.ndarray) -> Tuple[np.ndarray, np.ndarray]:
    valid_columns = np.mean(alignment == "-", axis=0) < threshold
    valid_length = sum(valid_columns)
    end_state = valid_length * 3 + 2
    transition_probs = create_transition_matrix(valid_length)
    emission_probs = create_emission_matrix(valid_length, len(alphabet))

    for sequence in alignment:
        prev_index = 0
        valid_col_count = -1
        for col, char in enumerate(sequence):
            if valid_columns[col]:
                valid_col_count += 1
                if char == "-":
                    current_index = calculate_index(valid_col_count, "del")
                else:
                    current_index = calculate_index(valid_col_count, "match")
                transition_probs[prev_index, current_index] += 1
                prev_index = current_index
            else:
                if char != "-":
                    current_index = calculate_index(valid_col_count, "ins")
                    transition_probs[prev_index, current_index] += 1
                    prev_index = current_index
            if char != "-":
                emission_probs[current_index, alphabet.index(char)] += 1
        transition_probs[prev_index, end_state] += 1

    transition_probs = normalize_matrix(transition_probs)
    emission_probs = normalize_matrix(emission_probs)

    return transition_probs, emission_probs

def add_pseudocounts_to_transitions(matrix: np.ndarray, pseudocount: float) -> np.ndarray:
    num_states = (matrix.shape[0] - 3) // 3
    matrix[0, 1:4] += pseudocount
    matrix[1, 1:4] += pseudocount
    for i in range(num_states):
        matrix[i*3+2:i*3+5, (i+1)*3+1:(i+1)*3+4] += pseudocount
    return normalize_matrix(matrix)

def add_pseudocounts_to_emissions(matrix: np.ndarray, pseudocount: float) -> np.ndarray:
    num_states = (matrix.shape[0] - 3) // 3
    matrix[1, :] += pseudocount
    for i in range(num_states):
        matrix[i*3+2, :] += pseudocount
        matrix[i*3+4, :] += pseudocount
    return normalize_matrix(matrix)

def build_profile_hmm_with_pseudocounts(threshold: float, pseudocount: float, alphabet: List[str], alignment: np.ndarray) -> Tuple[np.ndarray, np.ndarray]:
    transition_probs, emission_probs = build_profile_hmm(threshold, alphabet, alignment)
    transition_probs = add_pseudocounts_to_transitions(transition_probs, pseudocount)
    emission_probs = add_pseudocounts_to_emissions(emission_probs, pseudocount)
    return transition_probs, emission_probs

def parse_input_data(input_iterator: Iterator[str]) -> Tuple[str, float, float, List[str], np.ndarray]:
    sequence = next(input_iterator).rstrip()
    next(input_iterator)
    threshold, pseudocount = map(float, next(input_iterator).rstrip().split())
    next(input_iterator)
    alphabet = next(input_iterator).split()
    next(input_iterator)
    alignment = np.array([list(x.strip()) for x in input_iterator])
    return sequence, threshold, pseudocount, alphabet, alignment

def convert_transition_probs_to_dict(matrix: np.ndarray) -> Dict[Tuple[str, str], float]:
    prob_dict = defaultdict(float)
    num_states = (matrix.shape[0] - 3) // 3
    labels = generate_state_labels(num_states)
    for i in range(matrix.shape[0]):
        for j in range(matrix.shape[0]):
            prob_dict[labels[i], labels[j]] = matrix[i][j]
    return prob_dict

def convert_emission_probs_to_dict(matrix: np.ndarray, alphabet: List[str]) -> Dict[Tuple[str, str], float]:
    prob_dict = defaultdict(float)
    num_states = (matrix.shape[0] - 3) // 3
    labels = generate_state_labels(num_states)
    for i in range(matrix.shape[0]):
        for j, symbol in enumerate(alphabet):
            prob_dict[labels[i], symbol] = matrix[i][j]
    return prob_dict

def build_hmm_graph(transition_probs: Dict[Tuple[str, str], float], num_states: int) -> Dict[str, List[Dict[str, float]]]:
    def add_edge(source: str, target: str) -> None:
        graph[source].append({"node": target, "weight": transition_probs[source, target]})

    graph = defaultdict(list)
    for target in ["I0", "M1", "D1"]:
        add_edge("S", target)
    for i in range(num_states):
        source = f"I{i}"
        for target in [source, f"M{i+1}", f"D{i+1}"]:
            add_edge(source, target)
    for i in range(1, num_states):
        for source in [f"M{i}", f"D{i}"]:
            for target in [f"M{i+1}", f"I{i}", f"D{i+1}"]:
                add_edge(source, target)
    for source in [f"I{num_states}", f"M{num_states}", f"D{num_states}"]:
        for target in [f"I{num_states}", "E"]:
            add_edge(source, target)

    return graph

def generate_topological_order(num_states: int, seq_length: int) -> Iterator[Tuple[str, int]]:
    yield ("S", 0)
    for j in range(num_states):
        yield (f"D{j+1}", 0)
    for i in range(seq_length):
        yield ("I0", i + 1)
        for j in range(num_states):
            for state_type in ["M", "D", "I"]:
                yield (f"{state_type}{j+1}", i + 1)
    yield ("E", seq_length + 1)

def get_previous_nodes(current_node: str, current_col: int, num_states: int, seq_length: int) -> List[Tuple[str, int]]:
    if current_node[0] == "E":
        return [(f"D{num_states}", seq_length), (f"M{num_states}", seq_length), (f"I{num_states}", seq_length)]
    state_num = int(current_node[1:])
    if current_col == 0:
        return [("S", 0)] if state_num == 1 else [(f"D{state_num-1}", 0)]
    elif current_node == "I0":
        return [("S", 0)] if current_col == 1 else [("I0", current_col - 1)]
    elif current_node == "M1":
        return [("S", 0)] if current_col == 1 else [("I0", current_col - 1)]
    elif current_node[0] == "I":
        return [(f"D{state_num}", 0)] if current_col == 1 else [(f"D{state_num}", current_col - 1), (f"M{state_num}", current_col - 1), (f"I{state_num}", current_col - 1)]
    elif current_node[0] == "M":
        return [(f"D{state_num-1}", 0)] if current_col == 1 else [(f"D{state_num-1}", current_col - 1), (f"M{state_num-1}", current_col - 1), (f"I{state_num-1}", current_col - 1)]
    elif current_node[0] == "D":
        return [("I0", current_col)] if state_num == 1 else [(f"D{state_num-1}", current_col), (f"M{state_num-1}", current_col), (f"I{state_num-1}", current_col)]
    else:
        print(f"Unhandled node: {current_node}")
        return []

def simplify_graph(graph: Dict[str, List[Dict[str, float]]]) -> Dict[str, Dict[str, float]]:
    return {k: {x["node"]: x["weight"] for x in v} for k, v in graph.items()}

# Main execution
def main(sample_input):
    input_lines = iter(StringIO(sample_input.strip()).readlines())
    sequence, threshold, pseudocount, alphabet, alignment = parse_input_data(input_lines)
    transition_probs, emission_probs = build_profile_hmm_with_pseudocounts(threshold, pseudocount, alphabet, alignment)
    num_states = (transition_probs.shape[0] - 3) // 3
    transition_probs_dict = convert_transition_probs_to_dict(transition_probs)
    emission_probs_dict = convert_emission_probs_to_dict(emission_probs, alphabet)

    graph = build_hmm_graph(transition_probs_dict, num_states)
    topological_order = generate_topological_order(num_states, len(sequence))
    simplified_graph = simplify_graph(graph)

    # Dynamic programming to find the most probable path
    previous_node = next(topological_order)
    scores = {previous_node: 0}
    backpointers = {previous_node: (None, None)}

    for current_node, current_col in topological_order:
        backpointers[(current_node, current_col)] = 0
        scores[(current_node, current_col)] = -inf
        for prev_node, prev_col in get_previous_nodes(current_node, current_col, num_states, len(sequence)):
            if prev_col < current_col and current_node != "E":
                emission_prob = emission_probs_dict[current_node, sequence[current_col - 1]]
            else:
                emission_prob = 1
            log_prob = log(simplified_graph[prev_node][current_node]) + log(emission_prob) + scores[(prev_node, prev_col)]
            if log_prob > scores[(current_node, current_col)]:
                scores[(current_node, current_col)] = log_prob
                backpointers[(current_node, current_col)] = (prev_node, prev_col)

    # Traceback to find the path
    path = []
    position = ("E", len(sequence) + 1)
    while position[0]:
        path.append(backpointers[position][0])
        position = backpointers[position]

    print(*path[::-1][2:])

sample_input = """
AEFDFDC
--------
0.4 0.01
--------
A   B   C   D   E   F
--------
ACDEFACADF
AFDA---CCF
A--EFD-FDC
ACAEF--A-C
ADDEFAAADF
"""

main(sample_input)

111 Estimate the Parameters of an HMM

Given: A sequence of emitted symbols x = x1… xn in an alphabet ∑ and a path \(π = π_1... π_n\) generated by a k-state HMM with unknown transition and emission probabilities.

Return: A matrix of transition probabilities Transition and a matrix of emission probabilities Emission that maximize \(Pr(x,π)\) over all possible matrices of transition and emission probabilities.

111.1 Sample Dataset

yzzzyxzxxx
--------
x   y   z
--------
BBABABABAB
--------
A   B   C

111.2 Sample Output

A   B   C
A   0.0 1.0 0.0
B   0.8 0.2 0.0
C   0.333   0.333   0.333
--------
    x   y   z
A   0.25    0.25    0.5
B   0.5 0.167   0.333
C   0.333   0.333   0.333

111.3 Solution

from io import StringIO
from collections import defaultdict
from typing import List, Tuple, Dict, Iterator, Union
import numpy as np

def normalize_row(row: np.ndarray, include_zeros: bool = False, minimum_value: float = 0.0) -> np.ndarray:
    if include_zeros and sum(row) == 0:
        row[:] = 1
    with np.errstate(divide="ignore", invalid="ignore"):
        normalized = row / sum(row)
        normalized[row == 0.0] = minimum_value
        return normalized

def normalize_matrix(matrix: np.ndarray, include_zeros: bool = False, minimum_value: float = 0.0) -> np.ndarray:
    return np.array([normalize_row(r, include_zeros=include_zeros, minimum_value=minimum_value) for r in matrix])

def print_matrix(matrix: np.ndarray, row_labels: List[str], column_labels: List[str]) -> None:
    print(*column_labels, sep="\t")
    for i, row in enumerate(matrix):
        r = [row_labels[i]] + [round(x, 3) if x > 0.0 else "0" for x in row]
        print(*r, sep="\t")

def parse_input(handle: Iterator[str]) -> Tuple[str, List[str], str, List[str]]:
    sequence = next(handle).rstrip()
    next(handle)
    alphabet = next(handle).split()
    next(handle)
    path = next(handle).rstrip()
    next(handle)
    states = next(handle).split()
    return sequence, alphabet, path, states

def convert_to_dict(matrix: np.ndarray, row_labels: List[str], column_labels: List[str]) -> Dict[Tuple[str, str], float]:
    result = defaultdict(float)
    for i in range(matrix.shape[0]):
        for j in range(matrix.shape[1]):
            result[row_labels[i], column_labels[j]] = matrix[i][j]
    return result

def estimate_transition_matrix(path: str, states: List[str], to_dict: bool = False) -> Union[np.ndarray, Dict[Tuple[str, str], float]]:
    transition_matrix = np.zeros((len(states), len(states)), dtype=float)
    for current_state, next_state in zip(path, path[1:]):
        transition_matrix[states.index(current_state)][states.index(next_state)] += 1
    transition_matrix = normalize_matrix(transition_matrix, include_zeros=True, minimum_value=1e-16)
    if to_dict:
        return convert_to_dict(transition_matrix, states, states)
    else:
        return transition_matrix

def estimate_emission_matrix(sequence: str, alphabet: List[str], path: str, states: List[str], to_dict: bool = False) -> Union[np.ndarray, Dict[Tuple[str, str], float]]:
    emission_matrix = np.zeros((len(states), len(alphabet)), dtype=float)
    for state, symbol in zip(path, sequence):
        emission_matrix[states.index(state)][alphabet.index(symbol)] += 1
    emission_matrix = normalize_matrix(emission_matrix, include_zeros=True, minimum_value=1e-16)
    if to_dict:
        return convert_to_dict(emission_matrix, states, alphabet)
    else:
        return emission_matrix

def main(sample_input: str) -> None:
    input_lines = iter(StringIO(sample_input.strip()).readlines())
    sequence, alphabet, path, states = parse_input(input_lines)
    transition_matrix = estimate_transition_matrix(path, states)
    emission_matrix = estimate_emission_matrix(sequence, alphabet, path, states)
    print_matrix(transition_matrix, states, states)
    print("--------")
    print_matrix(emission_matrix, states, alphabet)

sample_input = """
yzzzyxzxxx
--------
x   y   z
--------
BBABABABAB
--------
A   B   C
"""

main(sample_input)

112 Implement Viterbi Learning

Given: A sequence of emitted symbols \(x=x_1... x_n\) in an alphabet A, generated by a k-state HMM with unknown transition and emission probabilities, initial Transition and Emission matrices and a number of iterations i.

Return: A matrix of transition probabilities Transition and a matrix of emission probabilities Emission that maximizes \(Pr(x,π)\) over all possible transition and emission matrices and over all hidden paths π.

112.1 Sample Dataset

100
--------
xxxzyzzxxzxyzxzxyxxzyzyzyyyyzzxxxzzxzyzzzxyxzzzxyzzxxxxzzzxyyxzzzzzyzzzxxzzxxxyxyzzyxzxxxyxzyxxyzyxz
--------
x   y   z
--------
A   B
--------
    A   B
A   0.582   0.418
B   0.272   0.728
--------
    x   y   z
A   0.129   0.35    0.52
B   0.422   0.151   0.426

112.2 Sample Output

A   B
A   0.875   0.125
B   0.011   0.989
--------
    x   y   z
A   0.0 0.75    0.25
B   0.402   0.174   0.424

112.3 Solution

from io import StringIO
from typing import List, Dict, Tuple
import numpy as np
from math import log

def viterbi(sequence: str, states: List[str], transition_matrix: Dict[Tuple[str, str], float], emission_matrix: Dict[Tuple[str, str], float]) -> str:
    mat = np.zeros((len(sequence), len(states)))
    ptr = np.zeros((len(sequence), len(states)), dtype=int)

    for i, state in enumerate(states):
        mat[0, i] = log(emission_matrix[state, sequence[0]] / len(states))

    for i, emission in enumerate(sequence[1:], start=1):
        for j, state in enumerate(states):
            opt = [
                log(transition_matrix[prev, state]) + log(emission_matrix[state, emission]) + mat[i - 1, k]
                for k, prev in enumerate(states)
            ]
            p = opt.index(max(opt))
            ptr[i, j] = p
            mat[i, j] = max(opt)
    ind = np.argmax(mat[i, :])

    state_sequence = states[ind]
    while i > 0:
        state_sequence = states[ptr[i, ind]] + state_sequence
        ind = ptr[i, ind]
        i -= 1
    return state_sequence

def print_matrix(matrix: np.ndarray, row_labels: List[str], column_labels: List[str]) -> None:
    print(*column_labels, sep="\t")
    for i, row in enumerate(matrix):
        r = [row_labels[i]] + [round(x, 3) if x > 0.0 else "0" for x in row]
        print(*r, sep="\t")

def normalize_matrix(matrix: np.ndarray, include_zeros: bool = True, min_val: float = 1e-16) -> np.ndarray:
    normalized = matrix / matrix.sum(axis=1, keepdims=True)
    if include_zeros:
        normalized[normalized == 0] = min_val
    return normalized

def estimate_transition_matrix(path: str, states: List[str], to_dict: bool = False) -> Dict[Tuple[str, str], float]:
    tmat = np.zeros((len(states), len(states)), dtype=float)
    for a, b in zip(path, path[1:]):
        tmat[states.index(a)][states.index(b)] += 1
    tmat = normalize_matrix(tmat)
    if to_dict:
        return {(states[i], states[j]): tmat[i, j] for i in range(len(states)) for j in range(len(states))}
    return tmat

def estimate_emission_matrix(sequence: str, alphabet: List[str], path: str, states: List[str], to_dict: bool = False) -> Dict[Tuple[str, str], float]:
    emat = np.zeros((len(states), len(alphabet)), dtype=float)
    for a, b in zip(path, sequence):
        emat[states.index(a)][alphabet.index(b)] += 1
    emat = normalize_matrix(emat)
    if to_dict:
        return {(states[i], alphabet[j]): emat[i, j] for i in range(len(states)) for j in range(len(alphabet))}
    return emat

def print_dict(d: Dict[Tuple[str, str], float], row_labels: List[str], column_labels: List[str]) -> None:
    mat = np.zeros((len(row_labels), len(column_labels)), dtype=float)
    for i, r in enumerate(row_labels):
        for j, c in enumerate(column_labels):
            mat[i, j] = d[r, c]
    print_matrix(mat, row_labels, column_labels)

def parse_input(handle: StringIO) -> Tuple[int, str, List[str], List[str], Dict[Tuple[str, str], float], Dict[Tuple[str, str], float]]:
    niter = int(next(handle).rstrip())
    next(handle)
    sequence = next(handle).rstrip()
    next(handle)
    alphabet = next(handle).split()
    next(handle)
    states = next(handle).split()
    next(handle)
    lines = [next(handle) for _ in range(len(states) + 1)]
    transition_matrix = {
        (states[i], states[j]): float(v)
        for i, x in enumerate(lines[1:])
        for j, v in enumerate(x.split()[1:])
    }
    next(handle)
    lines = [next(handle) for i in range(len(states) + 1)]
    emission_matrix = {
        (states[i], alphabet[j]): float(v)
        for i, x in enumerate(lines[1:])
        for j, v in enumerate(x.split()[1:])
    }
    return niter, sequence, states, alphabet, transition_matrix, emission_matrix

def main(sample_input: str) -> None:
    input_lines = StringIO(sample_input.strip())
    niter, sequence, states, alphabet, transition_matrix, emission_matrix = parse_input(input_lines)
    for _ in range(niter):
        path = viterbi(sequence, states, transition_matrix, emission_matrix)
        transition_matrix = estimate_transition_matrix(path, states, to_dict=True)
        emission_matrix = estimate_emission_matrix(sequence, alphabet, path, states, to_dict=True)
    print_dict(transition_matrix, states, states)
    print("--------")
    print_dict(emission_matrix, states, alphabet)

sample_input = """
100
--------
xxxzyzzxxzxyzxzxyxxzyzyzyyyyzzxxxzzxzyzzzxyxzzzxyzzxxxxzzzxyyxzzzzzyzzzxxzzxxxyxyzzyxzxxxyxzyxxyzyxz
--------
x   y   z
--------
A   B
--------
    A   B
A   0.582   0.418
B   0.272   0.728
--------
    x   y   z
A   0.129   0.35    0.52
B   0.422   0.151   0.426
"""

main(sample_input)

113 Solve the Soft Decoding Problem

Given: A string x, followed by the alphabet Σ from which x was constructed, followed by the states States, transition matrix Transition, and emission matrix Emission of an HMM (ΣStatesTransitionEmission).

Return: The probability \(Pr(π_i=k|x)\) that the HMM was in state k at step i (for each state k and each step i).

113.1 Sample Dataset

zyxxxxyxzz
--------
x   y   z
--------
A   B
--------
    A   B
A   0.911   0.089
B   0.228   0.772
--------
    x   y   z
A   0.356   0.191   0.453 
B   0.04    0.467   0.493

113.2 Sample Output

A   B 
0.5438  0.4562 
0.6492  0.3508 
0.9647  0.0353 
0.9936  0.0064 
0.9957  0.0043 
0.9891  0.0109 
0.9154  0.0846 
0.964   0.036 
0.8737  0.1263 
0.8167  0.1833

113.3 Solution

from typing import List, Dict, Tuple, Iterator
from io import StringIO
import numpy as np

def parse_input(handle: Iterator[str]) -> Tuple[str, List[str], Dict[Tuple[str, str], float], Dict[Tuple[str, str], float]]:
    seq: str = next(handle).rstrip()
    next(handle)
    alphabet: List[str] = next(handle).split()
    next(handle)
    states: List[str] = next(handle).split()
    next(handle)
    lines: List[str] = [next(handle) for _ in range(len(states) + 1)]
    tmat: Dict[Tuple[str, str], float] = {
        (states[i], states[j]): float(v)
        for i, x in enumerate(lines[1:])
        for j, v in enumerate(x.split()[1:])
    }
    next(handle)
    lines = [next(handle) for i in range(len(states) + 1)]
    emat: Dict[Tuple[str, str], float] = {
        (states[i], alphabet[j]): float(v)
        for i, x in enumerate(lines[1:])
        for j, v in enumerate(x.split()[1:])
    }
    return seq, states, tmat, emat

def forward(seq: str, states: List[str], tmat: Dict[Tuple[str, str], float], emat: Dict[Tuple[str, str], float]) -> np.ndarray:
    mat: np.ndarray = np.ones((len(seq), len(states)))

    for i, state in enumerate(states):
        mat[0, i] = emat[state, seq[0]]
    for i, emission in enumerate(seq[1:], start=1):
        for j, state in enumerate(states):
            mat[i, j] = sum(
                tmat[prev, state] * emat[state, emission] * mat[i - 1, k]
                for k, prev in enumerate(states)
            )

    return mat

def backward(seq: str, states: List[str], tmat: Dict[Tuple[str, str], float], emat: Dict[Tuple[str, str], float]) -> np.ndarray:
    mat: np.ndarray = np.ones((len(seq), len(states)))

    for i, emission in enumerate(seq[::-1][:-1], start=1):
        for j, state in enumerate(states):
            mat[len(seq) - i - 1, j] = sum(
                tmat[state, prev] * emat[prev, emission] * mat[len(seq) - i, k]
                for k, prev in enumerate(states)
            )
    return mat

def soft_decode(seq: str, states: List[str], tmat: Dict[Tuple[str, str], float], emat: Dict[Tuple[str, str], float], normalise: bool = True) -> np.ndarray:
    tot: np.ndarray = forward(seq, states, tmat, emat) * backward(seq, states, tmat, emat)
    if normalise:
        tot = tot / np.sum(tot, axis=1, keepdims=True)
    return tot

def main(sample_input: str) -> None:
    input_lines: Iterator[str] = StringIO(sample_input.strip())
    seq, states, tmat, emat = parse_input(input_lines)
    tot: np.ndarray = soft_decode(seq, states, tmat, emat)
    print(*states, sep="\t")
    for r in np.round(tot, 4):
        print(*r, sep="\t")

sample_input: str = """
zyxxxxyxzz
--------
x   y   z
--------
A   B
--------
    A   B
A   0.911   0.089
B   0.228   0.772
--------
    x   y   z
A   0.356   0.191   0.453 
B   0.04    0.467   0.493
"""

main(sample_input)

114 Implement Baum-Welch Learning

Given: A sequence of emitted symbols \(x=x_1...x_n\) in an alphabet A, generated by a k-state HMM with unknown transition and emission probabilities, initial Transition and Emission matrices and a number of iterations I.

Return: A matrix of transition probabilities Transition and a matrix of emission probabilities Emission that maximizes \(Pr(x,π)\) over all possible transition and emission matrices and over all hidden paths π.

114.1 Sample Dataset

10
--------
xzyyzyzyxy
--------
x   y   z
--------
A   B
--------
    A   B
A   0.019   0.981 
B   0.668   0.332 
--------
x   y   z
A   0.175   0.003   0.821 
B   0.196   0.512   0.293

114.2 Sample Output

A   B
A   0.000   1.000   
B   0.786   0.214   
--------
    x   y   z
A   0.242   0.000   0.758   
B   0.172   0.828   0.000

114.3 Solution

from typing import List, Dict, Tuple, Iterator
from io import StringIO
import numpy as np
from collections import defaultdict

def print_matrix(matrix: np.ndarray, row_labels: List[str], col_labels: List[str]) -> None:
    print(*col_labels, sep="\t")
    for i, row in enumerate(matrix):
        r = [row_labels[i]] + [round(x, 3) if x > 0.0 else "0" for x in row]
        print(*r, sep="\t")

def print_dict(d: Dict[Tuple[str, str], float], row_labels: List[str], col_labels: List[str]) -> None:
    mat = np.zeros((len(row_labels), len(col_labels)), dtype=float)
    for i, r in enumerate(row_labels):
        for j, c in enumerate(col_labels):
            mat[i, j] = d[r, c]
    print_matrix(mat, row_labels, col_labels)

def parse_input(handle: Iterator[str]) -> Tuple[int, str, List[str], List[str], Dict[Tuple[str, str], float], Dict[Tuple[str, str], float]]:
    niter = int(next(handle).rstrip())
    next(handle)
    seq = next(handle).rstrip()
    next(handle)
    alphabet = next(handle).split()
    next(handle)
    states = next(handle).split()
    next(handle)
    lines = [next(handle) for _ in range(len(states) + 1)]
    tmat = {
        (states[i], states[j]): float(v)
        for i, x in enumerate(lines[1:])
        for j, v in enumerate(x.split()[1:])
    }
    next(handle)
    lines = [next(handle) for _ in range(len(states) + 1)]
    emat = {
        (states[i], alphabet[j]): float(v)
        for i, x in enumerate(lines[1:])
        for j, v in enumerate(x.split()[1:])
    }
    return niter, seq, states, alphabet, tmat, emat

def forward(seq: str, states: List[str], tmat: Dict[Tuple[str, str], float], emat: Dict[Tuple[str, str], float]) -> np.ndarray:
    mat = np.ones((len(seq), len(states)))
    for i, state in enumerate(states):
        mat[0, i] = emat[state, seq[0]]
    for i, emission in enumerate(seq[1:], start=1):
        for j, state in enumerate(states):
            mat[i, j] = sum(
                tmat[prev, state] * emat[state, emission] * mat[i - 1, k]
                for k, prev in enumerate(states)
            )
    return mat

def backward(seq: str, states: List[str], tmat: Dict[Tuple[str, str], float], emat: Dict[Tuple[str, str], float]) -> np.ndarray:
    mat = np.ones((len(seq), len(states)))
    for i, emission in enumerate(seq[::-1][:-1], start=1):
        for j, state in enumerate(states):
            mat[len(seq) - i - 1, j] = sum(
                tmat[state, prev] * emat[prev, emission] * mat[len(seq) - i, k]
                for k, prev in enumerate(states)
            )
    return mat

def soft_decode(seq: str, states: List[str], tmat: Dict[Tuple[str, str], float], emat: Dict[Tuple[str, str], float], normalise: bool = True) -> np.ndarray:
    tot = forward(seq, states, tmat, emat) * backward(seq, states, tmat, emat)
    if normalise:
        tot = tot / np.sum(tot, axis=1, keepdims=True)
    return tot

def as_dict(x: np.ndarray, r: List[str], c: List[str]) -> Dict[Tuple[str, str], float]:
    g = defaultdict(float)
    for i in range(x.shape[0]):
        for j in range(x.shape[1]):
            g[r[i], c[j]] = x[i][j]
    return g

def estimate_pi2(seq: str, fwd: np.ndarray, bak: np.ndarray, tmat: Dict[Tuple[str, str], float], emat: Dict[Tuple[str, str], float], states: List[str]) -> np.ndarray:
    rep_mat = np.zeros((fwd.shape[0] - 1, len(states), len(states)), dtype=float)
    for i in range(0, fwd.shape[0] - 1):
        for j, s1 in enumerate(states):
            for k, s2 in enumerate(states):
                weight = tmat[s1, s2] * emat[s2, seq[i + 1]]
                rep_mat[i, j, k] = (
                    fwd[i, j] * bak[i + 1, k] * weight / sum(fwd[i, :] * bak[i, :])
                )
    return rep_mat

def estimate_tmat(seq: str, st: List[str], tmat: Dict[Tuple[str, str], float], emat: Dict[Tuple[str, str], float]) -> Dict[Tuple[str, str], float]:
    fwd = forward(seq, st, tmat, emat)
    bak = backward(seq, st, tmat, emat)
    pi2 = estimate_pi2(seq, fwd, bak, tmat, emat, st)
    tmat_new = np.sum(pi2, 0)
    tmat_new = tmat_new / np.sum(tmat_new, axis=1, keepdims=True)
    return as_dict(tmat_new, st, st)

def estimate_emat(seq: str, al: List[str], st: List[str], tmat: Dict[Tuple[str, str], float], emat: Dict[Tuple[str, str], float]) -> Dict[Tuple[str, str], float]:
    pi1 = soft_decode(seq, st, tmat, emat)
    emat_new = np.zeros((len(st), len(al)), dtype=float)
    for i, emission in enumerate(al):
        ind = np.array(list(seq)) == emission
        emat_new[:, i] = np.sum(pi1[ind, :], 0)
    emat_new = emat_new / np.sum(emat_new, axis=1, keepdims=True)
    return as_dict(emat_new, st, al)

def main(sample_input: str) -> None:
    input_lines = StringIO(sample_input.strip())
    niter, seq, st, al, tmat, emat = parse_input(input_lines)
    for _ in range(niter):
        tmat2 = estimate_tmat(seq, st, tmat, emat)
        emat2 = estimate_emat(seq, al, st, tmat, emat)
        emat, tmat = emat2, tmat2
    print_dict(tmat, st, st)
    print("--------")
    print_dict(emat, st, al)

sample_input: str = """
10
--------
xzyyzyzyxy
--------
x   y   z
--------
A   B
--------
    A   B
A   0.019   0.981 
B   0.668   0.332 
--------
x   y   z
A   0.175   0.003   0.821 
B   0.196   0.512   0.293
"""

main(sample_input)

115 Construct the Graph of a Spectrum

Spectrum Graph Construction. Construct the graph of a spectrum.

Given: A space-delimited list of integers Spectrum.

Return: Graph(Spectrum).

Note: In this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X and Z having respective integer masses 4 and 5.

115.1 Sample Dataset

57 71 154 185 301 332 415 429 486

115.2 Sample Output

0->57:G
0->71:A
57->154:P
57->185:K
71->185:N
154->301:F
185->332:F
301->415:N
301->429:K
332->429:P
415->486:A
429->486:G

115.3 Solution

from collections import defaultdict
from typing import List, Dict, DefaultDict

# Amino acid weights dictionary
amino_acid_weights: Dict[str, int] = {
    'G': 57, 'A': 71, 'S': 87, 'P': 97, 'V': 99,
    'T': 101, 'C': 103, 'I': 113, 'L': 113, 'N': 114,
    'D': 115, 'K': 128, 'Q': 128, 'E': 129, 'M': 131,
    'H': 137, 'F': 147, 'R': 156, 'Y': 163, 'W': 186
}

def spectrum_graph(masses: List[int]) -> DefaultDict[int, List[Dict[str, int]]]:
    # Reverse mapping of weights to amino acids
    weight_to_amino_acid: Dict[int, str] = {weight: aa for aa, weight in amino_acid_weights.items()}
    
    graph: DefaultDict[int, List[Dict[str, int]]] = defaultdict(list)
    
    # Create graph based on mass differences
    for i in range(len(masses)):
        for j in range(i + 1, len(masses)):
            difference: int = masses[j] - masses[i]
            if difference in weight_to_amino_acid:
                graph[masses[i]].append({"n": masses[j], "l": weight_to_amino_acid[difference]})
    
    return graph

# Sample input
sample_input: str = "57 71 154 185 301 332 415 429 486"
masses: List[int] = [0] + list(map(int, sample_input.split()))

# Print the spectrum graph
for start_mass, edges in spectrum_graph(masses).items():
    for edge in edges:
        print(f"{start_mass}->{edge['n']}:{edge['l']}")

116 Implement DecodingIdealSpectrum

Decoding an Ideal Spectrum Problem. Reconstruct a peptide from its ideal spectrum.

Given: A space-delimited list of integers, Spectrum.

Return: An amino acid string with an ideal spectrum that matches Spectrum.

Note: In this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X and Z having respective integer masses 4 and 5.

116.1 Sample Dataset

57 71 154 185 301 332 415 429 486

116.2 Sample Output

GPFNA

116.3 Solution

from typing import Dict, List, Tuple

amino_acid_masses: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163
}
mass_to_amino_acid: Dict[int, str] = {v: k for k, v in amino_acid_masses.items()}


def create_spectrum_graph(spectrum: List[int]) -> List[List[int]]:
    adjacency_list: List[List[int]] = []
    for i in range(len(spectrum)):
        for j in range(i, len(spectrum)):
            if spectrum[j] - spectrum[i] in mass_to_amino_acid.keys():
                adjacency_list.append([spectrum[i], spectrum[j], mass_to_amino_acid[spectrum[j] - spectrum[i]]])
    return adjacency_list


def calculate_ideal_spectrum(peptide: str) -> List[int]:
    prefix_mass: List[int] = [0]
    for i in range(len(peptide)):
        temp = prefix_mass[i] + amino_acid_masses[peptide[i]]
        prefix_mass.append(temp)
    linear_spectrum: List[int] = [0]
    for i in range(len(peptide)):
        for j in range(i + 1, len(peptide) + 1):
            linear_spectrum.append(prefix_mass[j] - prefix_mass[i])
    linear_spectrum.sort()
    return linear_spectrum


def find_paths(adjacency_list: List[List[int]]) -> List[str]:
    node: int = 0
    peptide_list: List[str] = []
    tmp_edges: List[List[List[int]]] = []
    peptide: str = ''
    tmp_peps: List[str] = []

    while any([len(x) != 0 for x in tmp_edges]) or len(tmp_edges) == 0:
        next_edges: List[List[int]] = [e for e in adjacency_list if e[0] == node]
        if len(next_edges) > 1:
            tmp = next_edges[1:]
            tmp_edges.append(tmp)
            tmp_peps.append(peptide)

        next_edge = next_edges[0]
        peptide += next_edge[2]
        node = next_edge[1]

        if len([e for e in adjacency_list if e[0] == node]) == 0:
            tmp = [x for x in tmp_edges if len(x) != 0][-1]
            next_edge = tmp.pop()
            node = next_edge[1]
            peptide_list.append(peptide)
            tmp_pep = tmp_peps.pop()
            peptide = tmp_pep + next_edge[2]

    return peptide_list


def decode_ideal_spectrum(spectrum: List[int]) -> str:
    adjacency_list = create_spectrum_graph(spectrum)
    all_paths = find_paths(adjacency_list)
    for peptide in all_paths:
        if set(spectrum).issubset(calculate_ideal_spectrum(peptide)):
            return peptide


sample_input: str = """
57 71 154 185 301 332 415 429 486
"""

spectrum: List[int] = [int(s) for s in sample_input.strip().split()]
spectrum = [0] + spectrum

print(decode_ideal_spectrum(spectrum))

117 Convert a Peptide into a Peptide Vector

Given: A peptide P.

Return: The peptide vector of P.

Note: In this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X and Z having respective integer masses 4 and 5.

117.1 Sample Dataset

XZZXX

117.2 Sample Output

0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 1 0 0 0 1

117.3 Solution

from typing import Dict, List

amino_acid_masses: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131, 'L': 113,
    'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163, 'X': 4, 'Z': 5
}


def create_peptide_vector(peptide: str) -> List[int]:
    prefix_masses: List[int] = []
    for i in range(len(peptide)):
        prefix = peptide[:i+1]
        mass = sum(amino_acid_masses[aa] for aa in prefix)
        prefix_masses.append(mass)

    vector: List[int] = [0] * prefix_masses[-1]
    for mass in prefix_masses:
        vector[mass - 1] = 1
    return vector


sample_input: str = """
XZZXX
"""
peptide: str = sample_input.strip()
print(' '.join(str(x) for x in create_peptide_vector(peptide)))

118 Convert a Peptide Vector into a Peptide

Given: A space-delimited binary vector P.

Return: A peptide whose binary peptide vector matches P. For masses with more than one amino acid, any choice may be used.

Note: In this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X and Z having respective integer masses 4 and 5.

118.1 Sample Dataset

0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 1 0 0 0 1

118.2 Sample Output

XZZXX

118.3 Solution

from typing import Dict, List

amino_acid_masses: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163
}
mass_to_amino_acid: Dict[int, str] = {v: k for k, v in amino_acid_masses.items()}
mass_to_amino_acid[4] = 'X'
mass_to_amino_acid[5] = 'Z'


def convert_peptide_vector_to_sequence(vector: List[int]) -> str:
    prefix_masses: List[int] = [i + 1 for i, v in enumerate(vector) if v == 1]

    peptide: str = mass_to_amino_acid[prefix_masses[0]]
    for i in range(1, len(prefix_masses)):
        mass = prefix_masses[i] - prefix_masses[i - 1]
        peptide += mass_to_amino_acid[mass]

    return peptide


sample_input: str = """
0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 1 0 0 0 1
"""
vector: List[int] = [int(x) for x in sample_input.strip().split()]

print(convert_peptide_vector_to_sequence(vector))

119 Sequence a Peptide

Peptide Sequencing Problem. Given a spectral vector S, find a peptide vector with maximum score against S.

Given: A space-delimited spectral vector S.

Return: A peptide with maximum score against S. For masses with more than one amino acid, any choice may be used.

Note: In this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X and Z having respective integer masses 4 and 5.

119.1 Sample Dataset

0 0 0 4 -2 -3 -1 -7 6 5 3 2 1 9 3 -8 0 3 1 2 1 0

119.2 Sample Output

XZZXX

119.3 Solution

from typing import Dict, List, Tuple

amino_acid_masses: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163
}
mass_to_amino_acid: Dict[int, str] = {v: k for k, v in amino_acid_masses.items()}


def sequence_peptide(spectral_vector: List[int]) -> str:
    spectral_vector = [0] + spectral_vector

    adjacency_list: List[List[int]] = []
    for i in range(len(spectral_vector)):
        for j in range(i, len(spectral_vector)):
            if (j - i) in mass_to_amino_acid.keys():
                adjacency_list.append([i, j])

    adjacency_dict: Dict[int, List[List[Union[int, str]]]] = {}
    for i in range(len(spectral_vector)):
        for j in range(i, len(spectral_vector)):
            if (j - i) in mass_to_amino_acid.keys():
                edge = [i, mass_to_amino_acid[j - i]]
                if j not in adjacency_dict:
                    adjacency_dict[j] = [edge]
                else:
                    adjacency_dict[j].append(edge)

    scores: Dict[int, List[Union[float, str]]] = {0: [0, '-']}
    for node in adjacency_dict.keys():
        scores[node] = [-float('inf'), '-']
        edges = adjacency_dict[node]
        for edge in edges:
            if edge[0] != 0:
                scores[edge[0]] = [-float('inf'), '-']

    for node in adjacency_dict.keys():
        max_score: float = -float('inf')
        best_edge: Union[str, List[Union[int, str]]] = '-'
        for parent in adjacency_dict[node]:
            score = scores[parent[0]][0]
            if score > max_score:
                max_score = score
                best_edge = parent
        scores[node] = [max_score + spectral_vector[node], best_edge]

    node: int = list(scores.keys())[-1]
    peptide: str = ''
    while node != 0:
        peptide = scores[node][1][1] + peptide
        node = scores[node][1][0]

    return peptide


sample_input: str = """
0 0 0 4 -2 -3 -1 -7 6 5 3 2 1 9 3 -8 0 3 1 2 1 0
"""

spectral_vector: List[int] = [int(x) for x in sample_input.split()]

print(sequence_peptide(spectral_vector))

120 Find a Highest-Scoring Peptide in a Proteome against a Spectrum

Peptide Identification Problem. Find a peptide from a proteome with maximum score against a spectrum.

Given: A space-delimited spectral vector S and an amino acid string Proteome.

Return: A peptide in Proteome with maximum score against S.

Note: In this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X and Z having respective integer masses 4 and 5.

120.1 Sample Dataset

0 0 0 4 -2 -3 -1 -7 6 5 3 2 1 9 3 -8 0 3 1 2 1 8
XZZXZXXXZXZZXZXXZ

120.2 Sample Output

ZXZXX

120.3 Solution

from typing import Dict, List

amino_acid_masses: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163,
    'X': 4, 'Z': 5  # Added 'X' and 'Z' with arbitrary masses
}

def create_peptide_vector(peptide: str) -> List[int]:
    prefix_masses: List[int] = [0]
    for amino_acid in peptide:
        prefix_masses.append(prefix_masses[-1] + amino_acid_masses[amino_acid])
    vector: List[int] = [0] * prefix_masses[-1]
    for mass in prefix_masses[1:]:
        vector[mass - 1] = 1
    return vector

def identify_peptide(spectral_vector: List[int], proteome: str) -> str:
    max_score: float = float('-inf')
    best_peptide: str = ""

    for i in range(len(proteome)):
        for j in range(i + 1, len(proteome) + 1):
            peptide: str = proteome[i:j]
            peptide_vector: List[int] = create_peptide_vector(peptide)
            
            if len(peptide_vector) > len(spectral_vector):
                break
            
            if len(peptide_vector) == len(spectral_vector):
                score: float = sum(s * v for s, v in zip(spectral_vector, peptide_vector))
                if score > max_score:
                    max_score = score
                    best_peptide = peptide

    return best_peptide

sample_input: str = """
0 0 0 4 -2 -3 -1 -7 6 5 3 2 1 9 3 -8 0 3 1 2 1 8
XZZXZXXXZXZZXZXXZ
"""
input_lines: List[str] = sample_input.strip().split("\n")
spectral_vector: List[int] = [int(x) for x in input_lines[0].strip().split()]
proteome: str = input_lines[1].strip()
print(identify_peptide(spectral_vector, proteome))

121 Implement PSMSearch

PSM Search Problem. Identify Peptide-Spectrum Matches by matching spectra against a proteome.

Given: A set of space-delimited spectral vectors SpectralVectors, an amino acid string Proteome, and a score threshold T.

Return: All unique Peptide-Spectrum Matches scoring at least as high as T.

Note: For this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X: 4, Z: 5.

121.1 Sample Dataset

-1 5 -4 5 3 -1 -4 5 -1 0 0 4 -1 0 1 4 4 4
-4 2 -2 -4 4 -5 -1 4 -1 2 5 -3 -1 3 2 -3
XXXZXZXXZXZXXXZXXZX
5

121.2 Sample Output

XZXZ

121.3 Solution

from typing import Dict, List, Set, Tuple

amino_acid_masses: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163,
    'X': 4, 'Z': 5  # Added 'X' and 'Z' with arbitrary masses
}

def is_number(n: str) -> bool:
    try:
        float(n)
    except ValueError:
        return False
    return True

def create_peptide_vector(peptide: str) -> List[int]:
    prefix_masses: List[int] = [0]
    for amino_acid in peptide:
        prefix_masses.append(prefix_masses[-1] + amino_acid_masses[amino_acid])
    vector: List[int] = [0] * prefix_masses[-1]
    for mass in prefix_masses[1:]:
        vector[mass - 1] = 1
    return vector

def identify_peptide(spectral_vector: List[int], proteome: str) -> Tuple[str, float]:
    max_score: float = float('-inf')
    best_peptide: str = ''

    for i in range(len(proteome)):
        for j in range(i + 1, len(proteome) + 1):
            peptide: str = proteome[i:j]
            peptide_vector: List[int] = create_peptide_vector(peptide)
            
            if len(peptide_vector) > len(spectral_vector):
                break
            
            if len(peptide_vector) == len(spectral_vector):
                score: float = sum(s * v for s, v in zip(spectral_vector, peptide_vector))
                if score > max_score:
                    max_score = score
                    best_peptide = peptide

    return best_peptide, max_score

def search_peptide_spectrum_matches(spectral_vectors: List[List[int]], proteome: str, threshold: float) -> Set[str]:
    psm_set: Set[str] = set()
    for vector in spectral_vectors:
        peptide, score = identify_peptide(vector, proteome)
        if score >= threshold:
            psm_set.add(peptide)
    return psm_set

sample_input: str = """
-1 5 -4 5 3 -1 -4 5 -1 0 0 4 -1 0 1 4 4 4
-4 2 -2 -4 4 -5 -1 4 -1 2 5 -3 -1 3 2 -3
XXXZXZXXZXZXXXZXXZX
5
"""
input_lines: List[str] = sample_input.strip().split("\n")

spectral_vectors: List[List[int]] = []
idx: int = 0
while idx < len(input_lines) and (is_number(input_lines[idx][0]) or is_number(input_lines[idx][:2])):
    vector: List[int] = [int(x) for x in input_lines[idx].strip().split()]
    spectral_vectors.append(vector)
    idx += 1

proteome: str = input_lines[idx].strip()
threshold: int = int(input_lines[idx + 1])

result: Set[str] = search_peptide_spectrum_matches(spectral_vectors, proteome, threshold)

for peptide in result:
    print(peptide)

122 Compute the Size of a Spectral Dictionary

Size of Spectral Dictionary Problem. Find the size of the spectral dictionary for a given spectrum and score threshold.

Given: A spectral vector Spectrum’, an integer threshold, and an integer max_score.

Return: The size of the dictionary *Dictionary__threshold(Spectrum’*).

Note: Use the provided max_score for the height of your table. Your answer should be the number of peptides whose score is at least threshold and at most max_score.

Note: In this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X and Z having respective integer masses 4 and 5.

122.1 Sample Dataset

4 -3 -2 3 3 -4 5 -3 -1 -1 3 4 1 3
1
8

122.2 Sample Output

0

122.3 Solution

from typing import Dict, List

amino_acid_masses: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163
}
mass_values: List[int] = list(amino_acid_masses.values())

def calculate_spectral_dictionary_size(spectral_vector: List[int], threshold: int, max_score: int) -> int:
    vector_length: int = len(spectral_vector)

    size_matrix: Dict[int, Dict[int, int]] = {0: {0: 1}}
    for t in range(1, max_score + 1):
        size_matrix[0][t] = 0

    for i in range(1, vector_length + 1):
        size_matrix[i] = {}
        for t in range(max_score + 1):
            size_matrix[i][t] = 0
            for mass in mass_values:
                if (i - mass) >= 0 and (t - spectral_vector[i - 1]) >= 0 and (t - spectral_vector[i - 1]) <= max_score:
                    size_matrix[i][t] += size_matrix[i - mass][t - spectral_vector[i - 1]]

    final_size: int = sum(size_matrix[vector_length][t] for t in range(threshold, max_score + 1))

    return final_size

sample_input: str = """
4 -3 -2 3 3 -4 5 -3 -1 -1 3 4 1 3
1
8
"""
input_lines: List[str] = sample_input.strip().split("\n")
spectral_vector: List[int] = [int(x) for x in input_lines[0].strip().split()]
threshold: int = int(input_lines[1])
max_score: int = int(input_lines[2])

print(calculate_spectral_dictionary_size(spectral_vector, threshold, max_score))

123 Compute the Probability of a Spectral Dictionary

Probability of Spectral Dictionary Problem. Find the probability of the spectral dictionary for a given spectrum and score threshold.

Given: A spectral vector Spectrum’, an integer threshold, and an integer max_score.

Return: The probability of the dictionary *Dictionary__threshold(Spectrum’*).

Note: Use the provided max_score for the height of your table.

Note: In this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X and Z having respective integer masses 4 and 5.

123.1 Sample Dataset

4 -3 -2 3 3 -4 5 -3 -1 -1 3 4 1 3
1
8

123.2 Sample Output

0

123.3 Solution

from typing import Dict, List

amino_acid_masses: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163
}
mass_values: List[int] = list(amino_acid_masses.values())

def calculate_spectral_dictionary_probability(spectral_vector: List[int], threshold: int, max_score: int) -> float:
    vector_length: int = len(spectral_vector)

    probability_matrix: Dict[int, Dict[int, float]] = {0: {0: 1.0}}
    for t in range(1, max_score + 1):
        probability_matrix[0][t] = 0.0

    for i in range(1, vector_length + 1):
        probability_matrix[i] = {}
        for t in range(max_score + 1):
            probability_matrix[i][t] = 0.0
            for mass in mass_values:
                if (i - mass) >= 0 and (t - spectral_vector[i - 1]) >= 0 and (t - spectral_vector[i - 1]) <= max_score:
                    probability_matrix[i][t] += probability_matrix[i - mass][t - spectral_vector[i - 1]]
            probability_matrix[i][t] /= 20

    final_probability: float = sum(probability_matrix[vector_length][t] for t in range(threshold, max_score + 1))

    return final_probability

sample_input: str = """
4 -3 -2 3 3 -4 5 -3 -1 -1 3 4 1 3
1
8
"""
input_lines: List[str] = sample_input.strip().split("\n")
spectral_vector: List[int] = [int(x) for x in input_lines[0].strip().split()]
threshold: int = int(input_lines[1])
max_score: int = int(input_lines[2])

print(calculate_spectral_dictionary_probability(spectral_vector, threshold, max_score))

124 Find a Highest-Scoring Modified Peptide against a Spectrum

Spectral Alignment Problem. Given a peptide and a spectral vector, find a modified variant of this peptide that maximizes the peptide-spectrum score among all variants of the peptides with up to k modifications.

Given: A peptide Peptide, a spectral vector Spectrum’, and an integer k.

Return: A peptide Peptide’ related to Peptide by up to k modifications with maximal score against Spectrum’ out of all possibilities.

Note: In this chapter, all dataset problems implicitly use the standard integer-valued mass table for the regular twenty amino acids. Examples sometimes use imaginary amino acids X and Z having respective integer masses 4 and 5.

124.1 Sample Dataset

XXZ
4 -3 -2 3 3 -4 5 -3 -1 -1 3 4 1 3
2

124.2 Sample Output

XX(-1)Z(+2)

124.3 Solution

from typing import Dict, List

amino_acid_masses: Dict[str, int] = {
    'A': 71, 'C': 103, 'E': 129, 'D': 115, 'G': 57, 'F': 147, 'I': 113, 'H': 137, 'K': 128, 'M': 131,
    'L': 113, 'N': 114, 'Q': 128, 'P': 97, 'S': 87, 'R': 156, 'T': 101, 'W': 186, 'V': 99, 'Y': 163,
    'X': 4, 'Z': 5  # Added 'X' and 'Z' with arbitrary masses
}

def print_score_matrix(score_matrix: Dict[int, Dict[int, Dict[int, float]]], prefix_masses: List[int], spectral_vector: List[int], max_k: int) -> None:
    for t in range(-2, max_k + 1):
        if t == -2:
            formatted_vector = [str(x).rjust(3) for x in spectral_vector]
            print('   ', *formatted_vector)
            print(' ')
            print(' ')
        elif t == -1:
            header = [str(i).rjust(3) for i in range(len(spectral_vector))]
            print('   ', *header)
        else:
            for mass in prefix_masses:
                row = []
                for j in range(-1, len(spectral_vector)):
                    if j == -1:
                        row.append(f"{mass:>3} ")
                    else:
                        score = score_matrix[mass][j][t]
                        if score < -1e5:
                            score = 'XX'
                        row.append(f"{score:>3}")
                print(' '.join(row))
            print(' ')
    return None

def spectral_alignment(peptide: str, spectral_vector: List[int], max_k: int) -> str:
    spectral_vector.insert(0, 0)

    # Calculate prefix masses
    prefix_masses = [0]
    for i in range(len(peptide)):
        prefix = peptide[:i + 1]
        mass = sum(amino_acid_masses[aa] for aa in prefix)
        prefix_masses.append(mass)

    # Create diff array
    mass_differences = {}
    for i in range(1, len(prefix_masses)):
        mass_differences[prefix_masses[i]] = prefix_masses[i] - prefix_masses[i - 1]

    # Initialize scores
    score_matrix: Dict[int, Dict[int, Dict[int, float]]] = {}
    for mass in prefix_masses:
        score_matrix[mass] = {}
        for j in range(len(spectral_vector)):
            score_matrix[mass][j] = {t: -float("inf") for t in range(max_k + 1)}
    score_matrix[0][0][0] = 0

    # Calculate scores
    for mass in prefix_masses[1:]:
        for j in range(len(spectral_vector)):
            for t in range(max_k + 1):
                if (t == 0) and (mass - mass_differences[mass] >= 0) and (j - mass_differences[mass] >= 0):
                    score_matrix[mass][j][t] = spectral_vector[j] + score_matrix[mass - mass_differences[mass]][j - mass_differences[mass]][t]
                elif (t > 0) and (mass - mass_differences[mass] >= 0) and (j - mass_differences[mass] >= 0):
                    score_matrix[mass][j][t] = spectral_vector[j] + max(score_matrix[mass - mass_differences[mass]][j - mass_differences[mass]][t], 
                                                                         max(score_matrix[mass - mass_differences[mass]][j_star][t - 1] for j_star in range(j)))
                elif (t > 0) and (mass - mass_differences[mass] >= 0) and (j > 0):
                    score_matrix[mass][j][t] = spectral_vector[j] + max(score_matrix[mass - mass_differences[mass]][j_star][t - 1] for j_star in range(j))

    # Find max score layer
    max_score = -float("inf")
    max_layer = 0
    for t in range(max_k + 1):
        current_score = score_matrix[prefix_masses[-1]][len(spectral_vector) - 1][t]
        if current_score > max_score:
            max_score = current_score
            max_layer = t

    # Backtrace
    layer = max_layer
    column_index = len(spectral_vector) - 1

    result_peptide = ''
    for i in range(len(peptide), 0, -1):
        pre_mass = prefix_masses[i]
        if (column_index - mass_differences[pre_mass] >= 0) and (
                score_matrix[pre_mass][column_index][layer] == spectral_vector[column_index] + score_matrix[pre_mass - mass_differences[pre_mass]][column_index - mass_differences[pre_mass]][layer]):
            column_index -= mass_differences[pre_mass]
            result_peptide = peptide[i - 1] + result_peptide
        else:
            temp_scores = [score_matrix[pre_mass - mass_differences[pre_mass]][j_star][layer - 1] for j_star in range(column_index)]
            idx_max_score = temp_scores.index(max(temp_scores))
            modification_amount = column_index - idx_max_score - mass_differences[pre_mass]
            if modification_amount > 0:
                result_peptide = peptide[i - 1] + '(+' + str(modification_amount) + ')' + result_peptide
            else:
                result_peptide = peptide[i - 1] + '(' + str(modification_amount) + ')' + result_peptide
            column_index = idx_max_score
            layer -= 1

    return result_peptide

sample_input: str = """
XXZ
4 -3 -2 3 3 -4 5 -3 -1 -1 3 4 1 3
2
"""
input_lines: List[str] = sample_input.strip().split("\n")
peptide_sequence: str = input_lines[0]
spectral_vector_values: List[int] = [int(x) for x in input_lines[1].strip().split()]
max_k_value: int = int(input_lines[2])

print(spectral_alignment(peptide_sequence, spectral_vector_values, max_k_value))